ID: 1030368754

View in Genome Browser
Species Human (GRCh38)
Location 7:108674036-108674058
Sequence GACAGATCTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030368750_1030368754 15 Left 1030368750 7:108673998-108674020 CCTGCCATCTTCTGCAGAAAACT No data
Right 1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG No data
1030368751_1030368754 11 Left 1030368751 7:108674002-108674024 CCATCTTCTGCAGAAAACTACTC No data
Right 1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030368754 Original CRISPR GACAGATCTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr