ID: 1030368755

View in Genome Browser
Species Human (GRCh38)
Location 7:108674037-108674059
Sequence ACAGATCTTGGCCTGTTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030368751_1030368755 12 Left 1030368751 7:108674002-108674024 CCATCTTCTGCAGAAAACTACTC No data
Right 1030368755 7:108674037-108674059 ACAGATCTTGGCCTGTTACTGGG No data
1030368750_1030368755 16 Left 1030368750 7:108673998-108674020 CCTGCCATCTTCTGCAGAAAACT No data
Right 1030368755 7:108674037-108674059 ACAGATCTTGGCCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030368755 Original CRISPR ACAGATCTTGGCCTGTTACT GGG Intergenic
No off target data available for this crispr