ID: 1030377471

View in Genome Browser
Species Human (GRCh38)
Location 7:108770320-108770342
Sequence CTTCTAGTTCCTGACTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030377471_1030377475 6 Left 1030377471 7:108770320-108770342 CCATCAAAGTCAGGAACTAGAAG No data
Right 1030377475 7:108770349-108770371 CTTAGGGAGTAAGTTTAGATGGG No data
1030377471_1030377477 29 Left 1030377471 7:108770320-108770342 CCATCAAAGTCAGGAACTAGAAG No data
Right 1030377477 7:108770372-108770394 AAGTTCTGAGAGCTGAGGCCTGG No data
1030377471_1030377473 -10 Left 1030377471 7:108770320-108770342 CCATCAAAGTCAGGAACTAGAAG No data
Right 1030377473 7:108770333-108770355 GAACTAGAAGAGATCACTTAGGG No data
1030377471_1030377474 5 Left 1030377471 7:108770320-108770342 CCATCAAAGTCAGGAACTAGAAG No data
Right 1030377474 7:108770348-108770370 ACTTAGGGAGTAAGTTTAGATGG No data
1030377471_1030377476 24 Left 1030377471 7:108770320-108770342 CCATCAAAGTCAGGAACTAGAAG No data
Right 1030377476 7:108770367-108770389 ATGGGAAGTTCTGAGAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030377471 Original CRISPR CTTCTAGTTCCTGACTTTGA TGG (reversed) Intergenic
No off target data available for this crispr