ID: 1030388686

View in Genome Browser
Species Human (GRCh38)
Location 7:108898802-108898824
Sequence TCATTTAGCAGGAGACTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030388686_1030388690 -3 Left 1030388686 7:108898802-108898824 CCTGTGAGTCTCCTGCTAAATGA No data
Right 1030388690 7:108898822-108898844 TGATAAGCTTATAGAAGGCTGGG No data
1030388686_1030388689 -4 Left 1030388686 7:108898802-108898824 CCTGTGAGTCTCCTGCTAAATGA No data
Right 1030388689 7:108898821-108898843 ATGATAAGCTTATAGAAGGCTGG No data
1030388686_1030388688 -8 Left 1030388686 7:108898802-108898824 CCTGTGAGTCTCCTGCTAAATGA No data
Right 1030388688 7:108898817-108898839 CTAAATGATAAGCTTATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030388686 Original CRISPR TCATTTAGCAGGAGACTCAC AGG (reversed) Intergenic
No off target data available for this crispr