ID: 1030388925

View in Genome Browser
Species Human (GRCh38)
Location 7:108901342-108901364
Sequence CCTCTTGTCCTTTAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030388925_1030388930 27 Left 1030388925 7:108901342-108901364 CCTTCCATCTAAAGGACAAGAGG No data
Right 1030388930 7:108901392-108901414 TCTTTCTTTTTGTCTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030388925 Original CRISPR CCTCTTGTCCTTTAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr