ID: 1030394339

View in Genome Browser
Species Human (GRCh38)
Location 7:108966801-108966823
Sequence AACCGAAACCACCATCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030394338_1030394339 -8 Left 1030394338 7:108966786-108966808 CCAAGCAGAGATGTCAACCGAAA No data
Right 1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG No data
1030394329_1030394339 28 Left 1030394329 7:108966750-108966772 CCAATATTTTCCCCTCTCTAATA No data
Right 1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG No data
1030394333_1030394339 16 Left 1030394333 7:108966762-108966784 CCTCTCTAATAACCTCTCCTGGG No data
Right 1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG No data
1030394337_1030394339 -7 Left 1030394337 7:108966785-108966807 CCCAAGCAGAGATGTCAACCGAA No data
Right 1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG No data
1030394336_1030394339 -1 Left 1030394336 7:108966779-108966801 CCTGGGCCCAAGCAGAGATGTCA No data
Right 1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG No data
1030394330_1030394339 18 Left 1030394330 7:108966760-108966782 CCCCTCTCTAATAACCTCTCCTG No data
Right 1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG No data
1030394335_1030394339 4 Left 1030394335 7:108966774-108966796 CCTCTCCTGGGCCCAAGCAGAGA No data
Right 1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG No data
1030394331_1030394339 17 Left 1030394331 7:108966761-108966783 CCCTCTCTAATAACCTCTCCTGG No data
Right 1030394339 7:108966801-108966823 AACCGAAACCACCATCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030394339 Original CRISPR AACCGAAACCACCATCTCAC TGG Intergenic
No off target data available for this crispr