ID: 1030396844

View in Genome Browser
Species Human (GRCh38)
Location 7:108996450-108996472
Sequence GGTTCGGAAGCTGCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030396844_1030396847 5 Left 1030396844 7:108996450-108996472 CCTGCAGTGGCAGCTTCCGAACC No data
Right 1030396847 7:108996478-108996500 AAACTCTAAAACTTACGTTGTGG No data
1030396844_1030396848 15 Left 1030396844 7:108996450-108996472 CCTGCAGTGGCAGCTTCCGAACC No data
Right 1030396848 7:108996488-108996510 ACTTACGTTGTGGCTTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030396844 Original CRISPR GGTTCGGAAGCTGCCACTGC AGG (reversed) Intergenic
No off target data available for this crispr