ID: 1030399144

View in Genome Browser
Species Human (GRCh38)
Location 7:109026732-109026754
Sequence CCTTGCATCCATGAATTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030399141_1030399144 2 Left 1030399141 7:109026707-109026729 CCTGGGTCTCATGGAGGCTTCAC No data
Right 1030399144 7:109026732-109026754 CCTTGCATCCATGAATTCTGAGG No data
1030399137_1030399144 19 Left 1030399137 7:109026690-109026712 CCATTTTCTCTCAGGGTCCTGGG No data
Right 1030399144 7:109026732-109026754 CCTTGCATCCATGAATTCTGAGG No data
1030399135_1030399144 24 Left 1030399135 7:109026685-109026707 CCACACCATTTTCTCTCAGGGTC No data
Right 1030399144 7:109026732-109026754 CCTTGCATCCATGAATTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030399144 Original CRISPR CCTTGCATCCATGAATTCTG AGG Intergenic
No off target data available for this crispr