ID: 1030400736

View in Genome Browser
Species Human (GRCh38)
Location 7:109046444-109046466
Sequence CTGGTTTCCTTGGACAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030400733_1030400736 3 Left 1030400733 7:109046418-109046440 CCTGCTACTATATGATATAACAG No data
Right 1030400736 7:109046444-109046466 CTGGTTTCCTTGGACAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030400736 Original CRISPR CTGGTTTCCTTGGACAATAC AGG Intergenic
No off target data available for this crispr