ID: 1030408898

View in Genome Browser
Species Human (GRCh38)
Location 7:109149243-109149265
Sequence CTGGTGAGAATGAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030408898_1030408904 26 Left 1030408898 7:109149243-109149265 CCCTTTTTCCTCATTCTCACCAG No data
Right 1030408904 7:109149292-109149314 AAATTCATTCTAACTGGTGTGGG No data
1030408898_1030408903 25 Left 1030408898 7:109149243-109149265 CCCTTTTTCCTCATTCTCACCAG No data
Right 1030408903 7:109149291-109149313 AAAATTCATTCTAACTGGTGTGG No data
1030408898_1030408902 20 Left 1030408898 7:109149243-109149265 CCCTTTTTCCTCATTCTCACCAG No data
Right 1030408902 7:109149286-109149308 TTGATAAAATTCATTCTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030408898 Original CRISPR CTGGTGAGAATGAGGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr