ID: 1030414540

View in Genome Browser
Species Human (GRCh38)
Location 7:109225771-109225793
Sequence CTGTTCCATTGTATTATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030414539_1030414540 13 Left 1030414539 7:109225735-109225757 CCATGGATGTAAGAGTTTATATC No data
Right 1030414540 7:109225771-109225793 CTGTTCCATTGTATTATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030414540 Original CRISPR CTGTTCCATTGTATTATGTA AGG Intergenic
No off target data available for this crispr