ID: 1030421313

View in Genome Browser
Species Human (GRCh38)
Location 7:109309964-109309986
Sequence AGAGGGAGGCTGCAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030421313_1030421321 29 Left 1030421313 7:109309964-109309986 CCACCCACCTGCAGCCTCCCTCT No data
Right 1030421321 7:109310016-109310038 GCCCACCTCCACTACTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030421313 Original CRISPR AGAGGGAGGCTGCAGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr