ID: 1030431253

View in Genome Browser
Species Human (GRCh38)
Location 7:109452177-109452199
Sequence CGGCAAACTGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030431253_1030431262 24 Left 1030431253 7:109452177-109452199 CCGTCCACCACTGCAGTTTGCCG No data
Right 1030431262 7:109452224-109452246 CCACCCCTCCGAATCCCGCAGGG No data
1030431253_1030431260 23 Left 1030431253 7:109452177-109452199 CCGTCCACCACTGCAGTTTGCCG No data
Right 1030431260 7:109452223-109452245 TCCACCCCTCCGAATCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030431253 Original CRISPR CGGCAAACTGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr