ID: 1030432623

View in Genome Browser
Species Human (GRCh38)
Location 7:109469970-109469992
Sequence TGTTCCCAGGAAAACCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030432623_1030432627 9 Left 1030432623 7:109469970-109469992 CCTACCAGGTTTTCCTGGGAACA No data
Right 1030432627 7:109470002-109470024 AAAATGCTTTAATACAAATCAGG No data
1030432623_1030432629 23 Left 1030432623 7:109469970-109469992 CCTACCAGGTTTTCCTGGGAACA No data
Right 1030432629 7:109470016-109470038 CAAATCAGGGTCTCTTTCTGAGG No data
1030432623_1030432628 10 Left 1030432623 7:109469970-109469992 CCTACCAGGTTTTCCTGGGAACA No data
Right 1030432628 7:109470003-109470025 AAATGCTTTAATACAAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030432623 Original CRISPR TGTTCCCAGGAAAACCTGGT AGG (reversed) Intergenic
No off target data available for this crispr