ID: 1030440638

View in Genome Browser
Species Human (GRCh38)
Location 7:109584222-109584244
Sequence GAGTGCCAAGCCAAGATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030440635_1030440638 2 Left 1030440635 7:109584197-109584219 CCCAGGGCTTCAGCACACAGCTT No data
Right 1030440638 7:109584222-109584244 GAGTGCCAAGCCAAGATCAATGG No data
1030440634_1030440638 3 Left 1030440634 7:109584196-109584218 CCCCAGGGCTTCAGCACACAGCT No data
Right 1030440638 7:109584222-109584244 GAGTGCCAAGCCAAGATCAATGG No data
1030440632_1030440638 9 Left 1030440632 7:109584190-109584212 CCCGTGCCCCAGGGCTTCAGCAC No data
Right 1030440638 7:109584222-109584244 GAGTGCCAAGCCAAGATCAATGG No data
1030440633_1030440638 8 Left 1030440633 7:109584191-109584213 CCGTGCCCCAGGGCTTCAGCACA No data
Right 1030440638 7:109584222-109584244 GAGTGCCAAGCCAAGATCAATGG No data
1030440636_1030440638 1 Left 1030440636 7:109584198-109584220 CCAGGGCTTCAGCACACAGCTTT No data
Right 1030440638 7:109584222-109584244 GAGTGCCAAGCCAAGATCAATGG No data
1030440631_1030440638 10 Left 1030440631 7:109584189-109584211 CCCCGTGCCCCAGGGCTTCAGCA No data
Right 1030440638 7:109584222-109584244 GAGTGCCAAGCCAAGATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030440638 Original CRISPR GAGTGCCAAGCCAAGATCAA TGG Intergenic
No off target data available for this crispr