ID: 1030441157

View in Genome Browser
Species Human (GRCh38)
Location 7:109591682-109591704
Sequence CAGTATGTTACTCTTGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030441157_1030441158 20 Left 1030441157 7:109591682-109591704 CCTTGTTCAAGAGTAACATACTG No data
Right 1030441158 7:109591725-109591747 TCAATACAATATTGCTCACATGG No data
1030441157_1030441159 23 Left 1030441157 7:109591682-109591704 CCTTGTTCAAGAGTAACATACTG No data
Right 1030441159 7:109591728-109591750 ATACAATATTGCTCACATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030441157 Original CRISPR CAGTATGTTACTCTTGAACA AGG (reversed) Intergenic
No off target data available for this crispr