ID: 1030455207

View in Genome Browser
Species Human (GRCh38)
Location 7:109763759-109763781
Sequence TTGATGCTTACTTGCAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030455207_1030455208 9 Left 1030455207 7:109763759-109763781 CCAGCATTGCAAGTAAGCATCAA 0: 1
1: 0
2: 2
3: 7
4: 97
Right 1030455208 7:109763791-109763813 AGTCATTCCCAGCAAGCATCTGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030455207 Original CRISPR TTGATGCTTACTTGCAATGC TGG (reversed) Intergenic
905158105 1:36005431-36005453 TGGATGCTTATTTTCAAAGCAGG - Intronic
908672197 1:66560241-66560263 TTGATGCATAATTACAATGTAGG + Intronic
910045811 1:82913953-82913975 TTGATTCTTACATGGAATGCAGG - Intergenic
911501377 1:98689535-98689557 TTTATGCTTACTTAAAATGTTGG + Intronic
915326589 1:155084014-155084036 TTGATGGTGACTAGCAAGGCAGG + Intronic
917929799 1:179815378-179815400 TGGATGCTTACATAGAATGCCGG - Exonic
918244996 1:182651450-182651472 GTGATACTCTCTTGCAATGCTGG - Intronic
922609651 1:226916062-226916084 TAGATGTTTACCTGAAATGCAGG + Intronic
1064932853 10:20646358-20646380 TTGTTGCTCATTTGCAAAGCAGG - Intergenic
1076189098 10:128470347-128470369 CTGATGCTTCCTTGCCAGGCCGG - Intergenic
1078123216 11:8531709-8531731 GTGATGCTGACTTCCAAGGCTGG - Intronic
1080743875 11:35090235-35090257 TTCATGCTTACTTTCAAGGCTGG - Intergenic
1081440868 11:43079306-43079328 AGGATGCTTGCTTGGAATGCTGG + Intergenic
1083703082 11:64493449-64493471 TTGATGTTGCCTTGCTATGCAGG - Intergenic
1083785984 11:64947579-64947601 TCTATTCTTACTTGCAAAGCTGG - Intronic
1086776620 11:90843124-90843146 TTGATGCTAACCAGTAATGCTGG + Intergenic
1087417435 11:97875220-97875242 TTGATGGTTGCTGGCAATCCTGG + Intergenic
1107327739 13:39263250-39263272 TTGATGTTTCCTTCCTATGCTGG - Intergenic
1110407563 13:75167899-75167921 TTGAAGTTAACTTCCAATGCTGG + Intergenic
1110865471 13:80389980-80390002 TTGATGCTTCTTTGGAATGTGGG + Intergenic
1112570898 13:100592064-100592086 TTGGACGTTACTTGCAATGCTGG - Intergenic
1113459575 13:110472607-110472629 TTGGGGCTTATTTGCAAAGCAGG + Intronic
1118664737 14:68055784-68055806 TTGATGCTTATTCTTAATGCTGG + Intronic
1121359126 14:93239929-93239951 TTGAGTCTTACTTGCAGTACCGG + Exonic
1121689778 14:95869194-95869216 TTTATGATAACTTACAATGCAGG - Intergenic
1122394579 14:101414494-101414516 CTGAGGCTTGCTGGCAATGCCGG + Intergenic
1123891198 15:24781323-24781345 TTTATCCAAACTTGCAATGCTGG + Intergenic
1130986563 15:88848256-88848278 CTGATGCTCCCCTGCAATGCTGG - Intronic
1131278831 15:91004931-91004953 TTGATTCTTTCTTCCTATGCAGG - Exonic
1141150639 16:81562454-81562476 TTGGGGCTAACTTGCAGTGCTGG + Intronic
1152958916 18:65430-65452 TTGATGTTTATTTGCAGTGATGG - Intronic
1157204209 18:45684895-45684917 TTGGTGCTTAATTGAAGTGCTGG - Intergenic
1158348705 18:56541905-56541927 TTCATGCTTCCTTTCAAAGCTGG - Intergenic
1165008982 19:32829698-32829720 GCGATGCTGACTGGCAATGCAGG + Intergenic
926990979 2:18679613-18679635 TTGATACTGAATTGCAGTGCAGG + Intergenic
927163530 2:20293251-20293273 TTGATGCTTACTTACAGAGAAGG - Intronic
928186016 2:29111540-29111562 TTAATGCTTGCTTGCCATTCTGG + Intronic
935436276 2:103037773-103037795 TTGAGTATTTCTTGCAATGCAGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
941442607 2:165556558-165556580 TTGATTCTTGGTTGCCATGCAGG - Intronic
943043858 2:182834789-182834811 TTAAGACTTACTTGCATTGCTGG - Exonic
944094082 2:195946833-195946855 TTCATGTTTACTTGCACTGTGGG + Intronic
944560388 2:200930170-200930192 GTGATGCTCTCTGGCAATGCAGG + Intronic
944693177 2:202176580-202176602 TTGTTGGTTACATGCATTGCAGG - Intronic
945487910 2:210420294-210420316 TTTAGGCTTTCTTGCAAGGCAGG + Intergenic
1169019893 20:2321907-2321929 TTAATACTTGCTTGCAAGGCAGG - Intronic
1170769587 20:19320362-19320384 TTGATGCTGAATTGCTATTCTGG + Intronic
1175294442 20:57898635-57898657 TTGATGCTTGCTTGCTCAGCAGG - Intergenic
1178629214 21:34244510-34244532 TTGATGCTTACTGGAAAGACAGG + Intergenic
1180556126 22:16577014-16577036 TTTATGCTAACTAGCAAGGCTGG - Intergenic
1181185682 22:21102050-21102072 TTGATGTTGACCTACAATGCAGG + Intergenic
952357075 3:32594347-32594369 TCGCTGCTTACTTGCACTGAGGG + Intergenic
952972942 3:38665991-38666013 CTGATGCTTCCCAGCAATGCTGG + Intergenic
955210552 3:56936488-56936510 GTGATGCTAATTTGCTATGCAGG - Intronic
956614285 3:71155882-71155904 TTCATGTTTACCTGCACTGCGGG - Intronic
957251024 3:77771300-77771322 TTGAGGCTTACTTTCAGTTCTGG - Intergenic
959214593 3:103435573-103435595 TTGTTGTTTAGTTGCAATGCAGG + Intergenic
960542717 3:118879361-118879383 TTGTTGCTTACTTATATTGCAGG - Intergenic
966369875 3:179239003-179239025 TTTATGCTAACTAGCAAGGCTGG - Exonic
967994864 3:195158830-195158852 AAGATGCTTACTAGGAATGCTGG + Intronic
968686877 4:1966171-1966193 TTGACCATTACTTGCAAGGCAGG - Intronic
970664841 4:18324860-18324882 ATAATACTTACTTGGAATGCAGG - Intergenic
971127926 4:23774802-23774824 TTGATTCCTACTTGCAGTGTGGG - Intronic
975810389 4:78162424-78162446 TTGCTGTTTTCTTGCACTGCAGG + Intronic
976541600 4:86283755-86283777 TTGATGGTTGCTTGTAGTGCAGG + Intronic
979140471 4:117166323-117166345 TTGATGCTTACTTCCAGTGCAGG - Intergenic
983202813 4:164880758-164880780 TTCATGCTTACTTGTAACACTGG - Intronic
983765174 4:171471441-171471463 TAAATGCTTAATTGCACTGCTGG + Intergenic
986238365 5:5933790-5933812 GTGTTGCTTGCTTGCAACGCAGG - Intergenic
986674934 5:10175789-10175811 TTGGTGGTTATTTGCCATGCAGG - Intergenic
990818672 5:59813132-59813154 TGGATGCTTACTTGCTGTTCTGG + Intronic
992832623 5:80609538-80609560 ATGATGTTTACTTATAATGCTGG - Intergenic
993229000 5:85207195-85207217 TTGATGAATACGTGCAATGAGGG + Intergenic
995792014 5:115898949-115898971 TTGATGCTTTCTTCCAATATGGG - Intronic
997997401 5:138597607-138597629 TTGATCCTTTCTTGCAATGAAGG - Intergenic
998786405 5:145714449-145714471 TTGATTCTTATTTTCAAAGCAGG - Intronic
1000900518 5:166906460-166906482 TTGTTGATTACTGGCAAAGCTGG + Intergenic
1001034152 5:168285214-168285236 TTCATGCTTCCTTTCAAAGCTGG - Intergenic
1003083668 6:3043501-3043523 TTGAACCTTACTTGCATTCCCGG - Intergenic
1004585519 6:16995879-16995901 TTGTTGTTTACTTGCAAAGGTGG - Intergenic
1010741167 6:79506980-79507002 TTAATGGTTAGTTGCAATGGAGG - Intronic
1012311264 6:97726250-97726272 TTGATACTTACTTTCAATTATGG - Intergenic
1013192520 6:107815679-107815701 TTGCTGATTACTTCCAACGCAGG - Intronic
1020566392 7:9801485-9801507 TTGATGTTTCCTTGCTATGCAGG - Intergenic
1021689321 7:23216874-23216896 TCTATGCTTACTGGCAGTGCTGG + Intergenic
1022304090 7:29129948-29129970 TTGATGTTTACCAGCAATCCTGG - Intronic
1026335764 7:69393190-69393212 TTGCTGCTGTCTTGCAATGCTGG - Intergenic
1027454198 7:78367347-78367369 TTCAAGCTAACTTCCAATGCAGG - Intronic
1030455207 7:109763759-109763781 TTGATGCTTACTTGCAATGCTGG - Intergenic
1036290804 8:7487969-7487991 TTGCTGGTTACCTGGAATGCTGG + Intronic
1036330685 8:7823568-7823590 TTGCTGGTTACCTGGAATGCTGG - Intronic
1037996516 8:23356483-23356505 CTCATGCTTACTGGCAGTGCTGG - Intronic
1042426526 8:68655559-68655581 ATGATGCTTTCTTGCAATGCTGG + Intronic
1042469005 8:69161869-69161891 TTGATGCCCACTGGCAATCCTGG + Intergenic
1043127052 8:76411984-76412006 TTGAAGTTTGCTGGCAATGCTGG - Intergenic
1044363427 8:91315172-91315194 TTTATGCATACTTGGAATGTTGG - Intronic
1051147618 9:14044577-14044599 TTGTTGTTTTCATGCAATGCTGG - Intergenic
1052272759 9:26643699-26643721 CTAATGCTTACTAGCTATGCAGG + Intergenic
1058963421 9:110013852-110013874 TTGATTCTTACTAGAAATGCTGG + Intronic
1060329604 9:122655004-122655026 TTGATGTATGTTTGCAATGCTGG - Intergenic
1060563070 9:124563788-124563810 ATGATACTCTCTTGCAATGCTGG + Intronic
1187054638 X:15731220-15731242 TTGAAACCTACTTGCCATGCTGG + Intronic
1188609095 X:32073560-32073582 TTGAATTTTACTTGCAATCCAGG - Intronic
1192299460 X:69884923-69884945 TACATTCTTACTAGCAATGCTGG + Intronic
1194154869 X:90375431-90375453 TTAATACTTATCTGCAATGCCGG + Intergenic
1195676198 X:107508966-107508988 TAGAGCCTTACTTGCAATACTGG + Intergenic
1200377571 X:155799898-155799920 ATGATTCTTACTTGGGATGCTGG + Intergenic