ID: 1030456378

View in Genome Browser
Species Human (GRCh38)
Location 7:109779858-109779880
Sequence TAACCTCCACCCAGTACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030456373_1030456378 8 Left 1030456373 7:109779827-109779849 CCTTTTTCCTGTTCTCTTCTATC No data
Right 1030456378 7:109779858-109779880 TAACCTCCACCCAGTACATGGGG No data
1030456372_1030456378 17 Left 1030456372 7:109779818-109779840 CCATGCTCTCCTTTTTCCTGTTC No data
Right 1030456378 7:109779858-109779880 TAACCTCCACCCAGTACATGGGG No data
1030456374_1030456378 1 Left 1030456374 7:109779834-109779856 CCTGTTCTCTTCTATCCTTCATT No data
Right 1030456378 7:109779858-109779880 TAACCTCCACCCAGTACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030456378 Original CRISPR TAACCTCCACCCAGTACATG GGG Intergenic
No off target data available for this crispr