ID: 1030459072

View in Genome Browser
Species Human (GRCh38)
Location 7:109808175-109808197
Sequence CCTCATGGATAATCTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030459064_1030459072 8 Left 1030459064 7:109808144-109808166 CCCAAGCAAAAATTTGCTGCAGG No data
Right 1030459072 7:109808175-109808197 CCTCATGGATAATCTCTGCTAGG No data
1030459066_1030459072 7 Left 1030459066 7:109808145-109808167 CCAAGCAAAAATTTGCTGCAGGG No data
Right 1030459072 7:109808175-109808197 CCTCATGGATAATCTCTGCTAGG No data
1030459063_1030459072 16 Left 1030459063 7:109808136-109808158 CCTGGATGCCCAAGCAAAAATTT No data
Right 1030459072 7:109808175-109808197 CCTCATGGATAATCTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030459072 Original CRISPR CCTCATGGATAATCTCTGCT AGG Intergenic
No off target data available for this crispr