ID: 1030461209

View in Genome Browser
Species Human (GRCh38)
Location 7:109839205-109839227
Sequence ACACTCCCACCAAGCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030461209_1030461212 13 Left 1030461209 7:109839205-109839227 CCAGGATGGCTTGGTGGGAGTGT No data
Right 1030461212 7:109839241-109839263 GCATGAAGCCCCTGCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030461209 Original CRISPR ACACTCCCACCAAGCCATCC TGG (reversed) Intergenic
No off target data available for this crispr