ID: 1030462613

View in Genome Browser
Species Human (GRCh38)
Location 7:109859528-109859550
Sequence TGTATGTTTTCAAACATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030462613_1030462618 15 Left 1030462613 7:109859528-109859550 CCTTTGATGTTTGAAAACATACA No data
Right 1030462618 7:109859566-109859588 AGAAATATCAGGGTAGGGCCAGG No data
1030462613_1030462619 23 Left 1030462613 7:109859528-109859550 CCTTTGATGTTTGAAAACATACA No data
Right 1030462619 7:109859574-109859596 CAGGGTAGGGCCAGGTGCAGTGG No data
1030462613_1030462617 10 Left 1030462613 7:109859528-109859550 CCTTTGATGTTTGAAAACATACA No data
Right 1030462617 7:109859561-109859583 TCTGTAGAAATATCAGGGTAGGG No data
1030462613_1030462614 4 Left 1030462613 7:109859528-109859550 CCTTTGATGTTTGAAAACATACA No data
Right 1030462614 7:109859555-109859577 TATGTCTCTGTAGAAATATCAGG No data
1030462613_1030462615 5 Left 1030462613 7:109859528-109859550 CCTTTGATGTTTGAAAACATACA No data
Right 1030462615 7:109859556-109859578 ATGTCTCTGTAGAAATATCAGGG No data
1030462613_1030462616 9 Left 1030462613 7:109859528-109859550 CCTTTGATGTTTGAAAACATACA No data
Right 1030462616 7:109859560-109859582 CTCTGTAGAAATATCAGGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030462613 Original CRISPR TGTATGTTTTCAAACATCAA AGG (reversed) Intergenic
No off target data available for this crispr