ID: 1030462615

View in Genome Browser
Species Human (GRCh38)
Location 7:109859556-109859578
Sequence ATGTCTCTGTAGAAATATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030462613_1030462615 5 Left 1030462613 7:109859528-109859550 CCTTTGATGTTTGAAAACATACA No data
Right 1030462615 7:109859556-109859578 ATGTCTCTGTAGAAATATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030462615 Original CRISPR ATGTCTCTGTAGAAATATCA GGG Intergenic
No off target data available for this crispr