ID: 1030465923

View in Genome Browser
Species Human (GRCh38)
Location 7:109903725-109903747
Sequence CATCAAGAAAAGAAAACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5151
Summary {0: 9, 1: 128, 2: 381, 3: 1321, 4: 3312}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030465923_1030465924 -10 Left 1030465923 7:109903725-109903747 CCTGTAGTTTTCTTTTCTTGATG 0: 9
1: 128
2: 381
3: 1321
4: 3312
Right 1030465924 7:109903738-109903760 TTTCTTGATGTGTACTTACTTGG No data
1030465923_1030465925 2 Left 1030465923 7:109903725-109903747 CCTGTAGTTTTCTTTTCTTGATG 0: 9
1: 128
2: 381
3: 1321
4: 3312
Right 1030465925 7:109903750-109903772 TACTTACTTGGTTTTGTATCAGG No data
1030465923_1030465926 12 Left 1030465923 7:109903725-109903747 CCTGTAGTTTTCTTTTCTTGATG 0: 9
1: 128
2: 381
3: 1321
4: 3312
Right 1030465926 7:109903760-109903782 GTTTTGTATCAGGTTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030465923 Original CRISPR CATCAAGAAAAGAAAACTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr