ID: 1030465924

View in Genome Browser
Species Human (GRCh38)
Location 7:109903738-109903760
Sequence TTTCTTGATGTGTACTTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030465923_1030465924 -10 Left 1030465923 7:109903725-109903747 CCTGTAGTTTTCTTTTCTTGATG 0: 9
1: 128
2: 381
3: 1321
4: 3312
Right 1030465924 7:109903738-109903760 TTTCTTGATGTGTACTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030465924 Original CRISPR TTTCTTGATGTGTACTTACT TGG Intergenic
No off target data available for this crispr