ID: 1030465936

View in Genome Browser
Species Human (GRCh38)
Location 7:109903876-109903898
Sequence GCTAGAGGTTTCACACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030465936_1030465938 4 Left 1030465936 7:109903876-109903898 CCTGGCTGTGTGAAACCTCTAGC No data
Right 1030465938 7:109903903-109903925 TTTTATAAAAATATTTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030465936 Original CRISPR GCTAGAGGTTTCACACAGCC AGG (reversed) Intergenic