ID: 1030471309

View in Genome Browser
Species Human (GRCh38)
Location 7:109965726-109965748
Sequence TTAGATGTCCACTGTTGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030471307_1030471309 -1 Left 1030471307 7:109965704-109965726 CCAAAAATTTCTCCAGACATTGT No data
Right 1030471309 7:109965726-109965748 TTAGATGTCCACTGTTGAAGTGG No data
1030471303_1030471309 22 Left 1030471303 7:109965681-109965703 CCCCCACAACACTCTCATGATAA No data
Right 1030471309 7:109965726-109965748 TTAGATGTCCACTGTTGAAGTGG No data
1030471305_1030471309 20 Left 1030471305 7:109965683-109965705 CCCACAACACTCTCATGATAACC No data
Right 1030471309 7:109965726-109965748 TTAGATGTCCACTGTTGAAGTGG No data
1030471304_1030471309 21 Left 1030471304 7:109965682-109965704 CCCCACAACACTCTCATGATAAC No data
Right 1030471309 7:109965726-109965748 TTAGATGTCCACTGTTGAAGTGG No data
1030471306_1030471309 19 Left 1030471306 7:109965684-109965706 CCACAACACTCTCATGATAACCA No data
Right 1030471309 7:109965726-109965748 TTAGATGTCCACTGTTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030471309 Original CRISPR TTAGATGTCCACTGTTGAAG TGG Intergenic
No off target data available for this crispr