ID: 1030471726

View in Genome Browser
Species Human (GRCh38)
Location 7:109972536-109972558
Sequence TAGGGTTGTAAATATGCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030471726_1030471731 19 Left 1030471726 7:109972536-109972558 CCTTTAGCATATTTACAACCCTA No data
Right 1030471731 7:109972578-109972600 GGCGAACCATCTCTAATTGCAGG No data
1030471726_1030471729 -2 Left 1030471726 7:109972536-109972558 CCTTTAGCATATTTACAACCCTA No data
Right 1030471729 7:109972557-109972579 TAACTGACCTTATTAAACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030471726 Original CRISPR TAGGGTTGTAAATATGCTAA AGG (reversed) Intergenic
No off target data available for this crispr