ID: 1030477172

View in Genome Browser
Species Human (GRCh38)
Location 7:110050399-110050421
Sequence TGCCCAATGCTGACTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030477169_1030477172 11 Left 1030477169 7:110050365-110050387 CCCTGGAAGACACATTAGAGAAA No data
Right 1030477172 7:110050399-110050421 TGCCCAATGCTGACTGTTGGAGG No data
1030477167_1030477172 23 Left 1030477167 7:110050353-110050375 CCCTAAAAGTGGCCCTGGAAGAC No data
Right 1030477172 7:110050399-110050421 TGCCCAATGCTGACTGTTGGAGG No data
1030477165_1030477172 29 Left 1030477165 7:110050347-110050369 CCTAAGCCCTAAAAGTGGCCCTG No data
Right 1030477172 7:110050399-110050421 TGCCCAATGCTGACTGTTGGAGG No data
1030477170_1030477172 10 Left 1030477170 7:110050366-110050388 CCTGGAAGACACATTAGAGAAAG No data
Right 1030477172 7:110050399-110050421 TGCCCAATGCTGACTGTTGGAGG No data
1030477168_1030477172 22 Left 1030477168 7:110050354-110050376 CCTAAAAGTGGCCCTGGAAGACA No data
Right 1030477172 7:110050399-110050421 TGCCCAATGCTGACTGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030477172 Original CRISPR TGCCCAATGCTGACTGTTGG AGG Intergenic
No off target data available for this crispr