ID: 1030478523

View in Genome Browser
Species Human (GRCh38)
Location 7:110071296-110071318
Sequence CAGTGTCACTGGAGGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030478523_1030478527 11 Left 1030478523 7:110071296-110071318 CCAAATTCCCTCCAGTGACACTG No data
Right 1030478527 7:110071330-110071352 TCTCCTCAATTCATTCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030478523 Original CRISPR CAGTGTCACTGGAGGGAATT TGG (reversed) Intergenic
No off target data available for this crispr