ID: 1030479471

View in Genome Browser
Species Human (GRCh38)
Location 7:110084029-110084051
Sequence AGTTTTCTGCAAAGGATGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030479471_1030479474 16 Left 1030479471 7:110084029-110084051 CCTGGCATCCTTTGCAGAAAACT No data
Right 1030479474 7:110084068-110084090 ACAGCTCTTGTTCTACTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030479471 Original CRISPR AGTTTTCTGCAAAGGATGCC AGG (reversed) Intergenic
No off target data available for this crispr