ID: 1030480948

View in Genome Browser
Species Human (GRCh38)
Location 7:110102939-110102961
Sequence CCACATATCAAGTACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030480948_1030480954 8 Left 1030480948 7:110102939-110102961 CCCTGCAGGTACTTGATATGTGG No data
Right 1030480954 7:110102970-110102992 GAATATCATTCTGGCTGAGAAGG No data
1030480948_1030480953 -1 Left 1030480948 7:110102939-110102961 CCCTGCAGGTACTTGATATGTGG No data
Right 1030480953 7:110102961-110102983 GTTCATTGGGAATATCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030480948 Original CRISPR CCACATATCAAGTACCTGCA GGG (reversed) Intergenic
No off target data available for this crispr