ID: 1030490025

View in Genome Browser
Species Human (GRCh38)
Location 7:110220699-110220721
Sequence ACCAAAAATATCTTCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030490025_1030490029 23 Left 1030490025 7:110220699-110220721 CCATGTCTGAAGATATTTTTGGT No data
Right 1030490029 7:110220745-110220767 TACTGGCCTCCAGTGGGTAAAGG No data
1030490025_1030490032 29 Left 1030490025 7:110220699-110220721 CCATGTCTGAAGATATTTTTGGT No data
Right 1030490032 7:110220751-110220773 CCTCCAGTGGGTAAAGGTCAGGG No data
1030490025_1030490027 16 Left 1030490025 7:110220699-110220721 CCATGTCTGAAGATATTTTTGGT No data
Right 1030490027 7:110220738-110220760 AACATGCTACTGGCCTCCAGTGG No data
1030490025_1030490030 28 Left 1030490025 7:110220699-110220721 CCATGTCTGAAGATATTTTTGGT No data
Right 1030490030 7:110220750-110220772 GCCTCCAGTGGGTAAAGGTCAGG No data
1030490025_1030490028 17 Left 1030490025 7:110220699-110220721 CCATGTCTGAAGATATTTTTGGT No data
Right 1030490028 7:110220739-110220761 ACATGCTACTGGCCTCCAGTGGG No data
1030490025_1030490026 6 Left 1030490025 7:110220699-110220721 CCATGTCTGAAGATATTTTTGGT No data
Right 1030490026 7:110220728-110220750 AACTAAGAAGAACATGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030490025 Original CRISPR ACCAAAAATATCTTCAGACA TGG (reversed) Intergenic
No off target data available for this crispr