ID: 1030495758

View in Genome Browser
Species Human (GRCh38)
Location 7:110297893-110297915
Sequence CCTGCTTTGGGGGAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030495758_1030495765 -5 Left 1030495758 7:110297893-110297915 CCATCCATCTCCCCCAAAGCAGG No data
Right 1030495765 7:110297911-110297933 GCAGGTCATAAAACCTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030495758 Original CRISPR CCTGCTTTGGGGGAGATGGA TGG (reversed) Intergenic
No off target data available for this crispr