ID: 1030496621

View in Genome Browser
Species Human (GRCh38)
Location 7:110308801-110308823
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 848
Summary {0: 14, 1: 45, 2: 114, 3: 231, 4: 444}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030496619_1030496621 -6 Left 1030496619 7:110308784-110308806 CCTTAGCTCAGCTAATCCAGGTT No data
Right 1030496621 7:110308801-110308823 CAGGTTCTTGTCTCATGACCAGG 0: 14
1: 45
2: 114
3: 231
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030496621 Original CRISPR CAGGTTCTTGTCTCATGACC AGG Intergenic
900753921 1:4420081-4420103 TGGGTTCTTGTCTCACAACCAGG + Intergenic
901481402 1:9527745-9527767 CAGGTTCTTGTCACACGACCAGG + Intergenic
902644711 1:17790377-17790399 CAAGTTCTTGTCCCATGCCCTGG + Intronic
903094801 1:20960731-20960753 CAGGGTCTTGTCTGTTGCCCTGG - Intronic
903955455 1:27022275-27022297 CGGGTTCTTCTCACAGGACCAGG - Intergenic
906410231 1:45573153-45573175 CAGGTTCTTGTCACATGAACAGG + Intergenic
906913592 1:49983079-49983101 CAAGTTCTTGTCCCATGTCCAGG - Intronic
908208361 1:61874027-61874049 TGGGTTCTTGTCTCATGATCAGG - Intronic
909388682 1:75092031-75092053 CAGGTTCTTTTCTTACGACCAGG + Intergenic
909395181 1:75163826-75163848 AGGGTTCTTCCCTCATGACCTGG - Intergenic
909771618 1:79430390-79430412 CAGGTTCTTTTCACACGACCAGG + Intergenic
909837622 1:80276703-80276725 CAGGTTCTTGTCTGGTGCCCAGG - Intergenic
909963624 1:81880446-81880468 CAGGTTCTTGTCTCAGTACCAGG + Intronic
910069970 1:83201058-83201080 TGGGTTATTGTCTCATGACCAGG - Intergenic
910189991 1:84585386-84585408 TGGGTTCTTGTCCCATGACCAGG + Intergenic
911281322 1:95933079-95933101 TGGGTTCTTGTATCACGACCAGG + Intergenic
911299762 1:96157631-96157653 CAGGTTCTTGTCACATGACCAGG + Intergenic
911734854 1:101325872-101325894 CAGGTTCTTGTCACACGACCAGG + Intergenic
911805010 1:102194789-102194811 TGGGTTCTTGTCTCATGACCAGG - Intergenic
912044533 1:105437611-105437633 CAAGCTCTTGTCCCATGTCCAGG - Intergenic
912094516 1:106121583-106121605 CAAGTTCTTGTCCCACGTCCAGG - Intergenic
912491741 1:110066250-110066272 CAGGAGCTTATCTCATGGCCTGG - Intronic
913030362 1:114896816-114896838 TAGGTTCTTGTCACATGACCAGG + Intronic
913030980 1:114902366-114902388 CGGGTTCTTGTCGCAGGATCAGG + Intronic
913103650 1:115592955-115592977 TGGGCTCTTGTCACATGACCAGG - Intergenic
913138289 1:115914150-115914172 CAGTCTCTGGTCTCTTGACCAGG - Intergenic
913406617 1:118500966-118500988 CAGGTTCTTATGTGATGGCCAGG - Intergenic
915104625 1:153525994-153526016 CAGGTTCTTGTGTTACAACCAGG + Intergenic
916463023 1:165046228-165046250 TAGGTTCTTCTCTCTAGACCTGG + Intergenic
916629723 1:166599124-166599146 TGGGTTCTTGTCTCACAACCAGG - Intergenic
916638772 1:166703346-166703368 CAGGTTCTTGTCACATGACCAGG - Intergenic
917098255 1:171421619-171421641 CAGGTTCTTGTCACATGACCAGG + Intergenic
917185816 1:172354220-172354242 TGAGTTCTTGTCTCTTGACCAGG + Intronic
917267334 1:173235225-173235247 CTGGTTCTTGTGTCACAACCAGG + Intergenic
917891326 1:179441130-179441152 CAGGCCCTTGTCTCGTTACCCGG + Intronic
918161272 1:181902274-181902296 TGGGTTCTTGTCACACGACCAGG - Intergenic
918175514 1:182040927-182040949 GGGGTTCTTGTCACATAACCAGG + Intergenic
918820681 1:189250371-189250393 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
920527587 1:206679172-206679194 CAGGTTCTTACCTGGTGACCTGG - Intronic
921736576 1:218634620-218634642 TGGGTTCTTGTCTCATGACCAGG - Intergenic
921802876 1:219421347-219421369 CATGTTGTTCTCTCATGATCTGG - Intergenic
921901773 1:220458396-220458418 TGGGTTCTTGTCACATGACCAGG - Intergenic
922041628 1:221903496-221903518 CAGATTCTTGTCTTATGACCAGG + Intergenic
922072847 1:222213379-222213401 CAGGTTCTTCCCTCAACACCTGG + Intergenic
922367631 1:224880864-224880886 TGGGTTCTTGTCACATGACCAGG - Intergenic
923245851 1:232131285-232131307 TGGGTTCTTGTCTCATGGCCAGG - Intergenic
923412620 1:233725230-233725252 CAGGTTCTTGTCACACGACCAGG + Intergenic
923414244 1:233739248-233739270 CAGGCTCTTGTCACACGACCAGG - Intergenic
923849918 1:237783142-237783164 CAGGATCTGGTCTGAAGACCTGG + Intronic
923900482 1:238320746-238320768 CAGGTTCTTGTCTCACAACCAGG - Intergenic
923917908 1:238529846-238529868 CAAGTTCTTGTCCCATGTCTAGG + Intergenic
924518336 1:244784358-244784380 TAGGTTCTTGGCTCTTGACTTGG + Intergenic
1062839017 10:655313-655335 CGGGTTCTTGTCTCACAACCAGG - Intronic
1063306725 10:4909516-4909538 CCGGTTCTTGTGTCATGACCAGG - Intergenic
1063307437 10:4918183-4918205 CAGGTTGTTGTGTTGTGACCAGG + Intergenic
1063978360 10:11434729-11434751 CAGGCTCTTGGCACACGACCAGG + Intergenic
1064175662 10:13072752-13072774 TGGGTTCATGTCACATGACCAGG - Intronic
1064257762 10:13758757-13758779 CAGCTTCTTGTCTCACGACCAGG - Intronic
1064512698 10:16112648-16112670 CTGGTTCTTGTCTTATGTCCTGG - Intergenic
1064598914 10:16973588-16973610 CACGTTCTTTGCTCATTACCTGG - Intronic
1065811039 10:29444095-29444117 TGGGTTCTTGTCACACGACCAGG + Intergenic
1066049740 10:31622146-31622168 CGAGTTCTTGTCTGACGACCAGG - Intergenic
1066188925 10:33037526-33037548 CAAGCTCTTGTCTCAGGTCCAGG - Intergenic
1066196313 10:33103849-33103871 GGGGTTCTTGTCTCACGACCAGG + Intergenic
1066241427 10:33539476-33539498 TGGGTTCTTGTCTCACGACCAGG - Intergenic
1066251492 10:33637390-33637412 CAGGTTCTTGTCCTGTGTCCAGG - Intergenic
1066508275 10:36067104-36067126 CGAGTTCTTGTCTCATGTCCAGG - Intergenic
1066749298 10:38636197-38636219 CAGGTTCTTGTCATACTACCAGG + Intergenic
1066967353 10:42281595-42281617 CAGGTTCTTGTCATACCACCAGG - Intergenic
1067133147 10:43584461-43584483 CAGGTTTTTGTTTCATAATCTGG + Intergenic
1068083645 10:52348075-52348097 CAAGATCTTGTCCTATGACCAGG - Intergenic
1068188563 10:53619626-53619648 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1068351298 10:55848828-55848850 CGGGTTCTTGTCCCACAACCAGG - Intergenic
1068417744 10:56745873-56745895 CGGGTTCTTGTCACAGAACCAGG - Intergenic
1068429370 10:56912057-56912079 CAGTTTCTTGCCTCAGCACCTGG + Intergenic
1068474485 10:57507572-57507594 CAAGTTCTTGTCCCATATCCAGG - Intergenic
1068527061 10:58142541-58142563 CAGGGTCTTGTCTGTTGCCCAGG - Intergenic
1068878428 10:62022622-62022644 TGGGTTCCTGTCACATGACCAGG - Intronic
1068906908 10:62336830-62336852 TGGGTTCTCGTCTCATGACCAGG - Intergenic
1069144079 10:64867341-64867363 GAGTTCTTTGTCTCATGACCAGG + Intergenic
1069329995 10:67280425-67280447 CAGGTTCTTGTCTCACAACCAGG + Intronic
1069575942 10:69528590-69528612 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
1069862346 10:71479648-71479670 CAGGTTATTGGGTCATGACTTGG + Intronic
1070406264 10:76100234-76100256 CAGGTTCTTGTCACATGATCAGG + Intronic
1071156215 10:82692441-82692463 TGGGTTCTTGTCTCAAGACCAGG + Intronic
1071326025 10:84519216-84519238 GGGGTTCTTGTGTCAGGACCAGG + Intergenic
1071960399 10:90804294-90804316 CAGGTTCTTGTCTGGTGTCCAGG - Intronic
1073558130 10:104473232-104473254 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1073664057 10:105510065-105510087 CGGGTTCTTGTCACATGACTAGG + Intergenic
1073903554 10:108250663-108250685 TGGGTTCTTGTGTCATGACCAGG - Intergenic
1074009865 10:109467250-109467272 CAGGCTCTTGTCTCATGACCAGG - Intergenic
1074738875 10:116464979-116465001 CAGGTTCTTGTCCCACGTCCAGG + Intronic
1074979586 10:118608844-118608866 TAAGTTCTTGTCCCATGTCCAGG + Intergenic
1075707273 10:124508973-124508995 CAGGTACTAGGCTTATGACCTGG - Intronic
1075875302 10:125800939-125800961 TGGGTTCTTGTCTCATGACCAGG - Intronic
1078736979 11:14029432-14029454 CGGGCTCTTGTCACATGATCAGG + Intronic
1078900682 11:15639640-15639662 CAGGTGCTTCTCTCCTGACCTGG - Intergenic
1079674086 11:23203020-23203042 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
1079888235 11:26016293-26016315 TGGGTTCTTGTCTCATGATTGGG - Intergenic
1080074564 11:28134150-28134172 CATGTTCTTGTCTCATGACCAGG + Intronic
1080075276 11:28140606-28140628 TAGGTTCTTGTCTCATGACCAGG + Intronic
1081069661 11:38595393-38595415 CAGGTTCTCATCTCAAGACCAGG - Intergenic
1081100581 11:38997043-38997065 CAGGTTCTTGTTACAAGACCAGG + Intergenic
1081435811 11:43026453-43026475 TGGATTCTTGTCACATGACCAGG + Intergenic
1081544759 11:44062880-44062902 CGGGTTCTTGTCACACCACCAGG - Intergenic
1081572915 11:44302689-44302711 CAGGTTCTGGGCTCAGGACTGGG - Intronic
1082036827 11:47651778-47651800 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1082079885 11:48004585-48004607 CTGATTCTTGTCTCAAGTCCTGG - Intronic
1082668996 11:56010561-56010583 CAGGTACTATGCTCATGACCAGG + Intergenic
1082944117 11:58740182-58740204 CAGGTTCTTGTCTCATGACTAGG - Intergenic
1085703220 11:78763601-78763623 CAGGTAGTTGTCAAATGACCCGG + Intronic
1085987547 11:81805231-81805253 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1086092834 11:83021200-83021222 CAAGTTCTTGTCCTATGACCAGG - Intronic
1086133632 11:83425097-83425119 GGGGTTCTTGTCACATGACCAGG + Intergenic
1086458901 11:86986020-86986042 CAGGTTCTTGTCACACGACCAGG - Intergenic
1087120023 11:94564046-94564068 CGAGTTCTTGTCACATGACCAGG + Intronic
1087439259 11:98161804-98161826 CAGGTCCTTGTCTGGTGTCCAGG - Intergenic
1087470058 11:98561714-98561736 TGGGTTCTTGTCTCATGAACAGG - Intergenic
1087887245 11:103495133-103495155 CAGGTTCTTGTCTGGCGTCCAGG - Intergenic
1088045273 11:105443401-105443423 CAGGTGCTGGTCTGATGACTAGG - Intergenic
1088100719 11:106152537-106152559 TGGGTTCTTGTCTCACGACCAGG - Intergenic
1088559340 11:111097125-111097147 CGGGCTCTTGTCACATGACCAGG + Intergenic
1088698283 11:112389061-112389083 GAGTTCTTTGTCTCATGACCAGG - Intergenic
1088748566 11:112824680-112824702 CAGGTTCTTGTCTCGTGTCCAGG - Intergenic
1089195607 11:116692545-116692567 CAGGTTCTGGTGTCCTGGCCTGG - Intergenic
1089561850 11:119347106-119347128 CATGTTCTTCTCTCTTGTCCTGG - Intergenic
1090706794 11:129344961-129344983 CGGGTTTTTGTCACACGACCAGG - Intergenic
1090728697 11:129551229-129551251 TGAGTTCTTGTCTCATGACCAGG - Intergenic
1090873400 11:130767664-130767686 CAGGTTGTTGTCTCACGACCGGG - Intergenic
1091019039 11:132082209-132082231 CCAGTTCTTGTTTCATGACCAGG + Intronic
1091019755 11:132088418-132088440 CCGGTTCTTATCTCACAACCAGG + Intronic
1091573039 12:1707498-1707520 CAGGGTCTTGTCTGTTGTCCAGG + Intronic
1091632479 12:2172347-2172369 CAGACTCTTGTCACATCACCAGG + Intronic
1092013819 12:5139925-5139947 TAGGTTTTTGTCTCATGAACAGG + Intergenic
1092061898 12:5557896-5557918 CGGGTTCTTGTCACATGCCCGGG + Intronic
1092585512 12:9897469-9897491 CAGGTTCTTGTCACACGACCAGG + Intergenic
1092698655 12:11202240-11202262 CAAGTTCTTGTCTCACAACCAGG - Intergenic
1093150494 12:15615538-15615560 AAGGTACTTGTTTCATGAGCCGG + Intergenic
1093331682 12:17851083-17851105 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1093705775 12:22273539-22273561 TGGGTTCTTGTCTCATGACCAGG - Intronic
1093753864 12:22830937-22830959 CAGGTCCTTGTCTCACAACTGGG + Intergenic
1094003218 12:25718748-25718770 CAGTTTCTTGTCACATGACCAGG - Intergenic
1094315348 12:29133470-29133492 TGGGTTCTTTTCTCATGACCAGG + Intergenic
1094317018 12:29146150-29146172 TGTGTTCTTGTCTCATAACCAGG + Intergenic
1094440484 12:30470582-30470604 TGGGTTCTTGTCCCATGACCAGG + Intergenic
1094443666 12:30506780-30506802 CAGGTTCTTGTCACACGACCAGG - Intergenic
1094638351 12:32248707-32248729 CAGGTTCTTGTCTCACAACCAGG + Intronic
1094716658 12:33020848-33020870 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1095345252 12:41142321-41142343 TGGGTTCTTGTCACACGACCAGG + Intergenic
1095968439 12:47884754-47884776 CAGGTTCTTCCCTCATGACCTGG - Intronic
1096294986 12:50376274-50376296 CAAGTTCCTGTCTCATGTCTAGG + Intronic
1096354423 12:50928301-50928323 CAGGTTCTTGTCTCACATTCAGG + Intronic
1096928213 12:55173100-55173122 CACGTTCTTGCCTCACAACCAGG - Intergenic
1097360743 12:58655850-58655872 TAAGTTCTTGTCCCATGTCCAGG + Intronic
1097419614 12:59358214-59358236 CAGGTTCTTTTCTCACAACCAGG - Intergenic
1098790623 12:74817315-74817337 AAGTTTCTTGTCCCATGTCCAGG - Intergenic
1099295459 12:80823159-80823181 CAAGTTCTTGTCCTATGTCCAGG - Intronic
1099529052 12:83752950-83752972 CAGGTTCTTGTCACACGACCAGG - Intergenic
1100233517 12:92634188-92634210 CGGGTTCTTGTCACATGACCAGG + Intergenic
1100263442 12:92953990-92954012 TGGGTTCTTGTCTCACGACCAGG + Intergenic
1100361617 12:93884736-93884758 CAGGTTCTTGTCACTCGACTGGG - Intronic
1100766773 12:97875016-97875038 CAGGTTCTTGTGTCACTACCAGG + Intergenic
1101775366 12:107788652-107788674 CGAGTTCTTGTGTCACGACCAGG + Intergenic
1104144199 12:126017265-126017287 CAAGTTCTTGTCTCACGACCAGG - Intergenic
1104220353 12:126776607-126776629 TGGGTTCTTGTCTCACAACCAGG - Intergenic
1105266690 13:18825115-18825137 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1106379609 13:29223635-29223657 CAAGTTCTTGTCCCATGTCCAGG - Intronic
1106431199 13:29682183-29682205 CGGGTTCTTGTCACACAACCAGG + Intergenic
1107147113 13:37070783-37070805 CAAGTTCTTGTCTTGTGACCAGG - Intergenic
1107841217 13:44459513-44459535 TGGGTTCTTGTCTCGTGTCCAGG - Intronic
1108160221 13:47631603-47631625 CAGGTTCTTATCTCACAACCAGG + Intergenic
1108584516 13:51858658-51858680 TGGGTTCTTGTCACATAACCAGG + Intergenic
1108605160 13:52030253-52030275 CAGGTTCCTCTCTCTGGACCTGG - Exonic
1108871140 13:54987962-54987984 CAGATTTTTGTCACATGACCAGG + Intergenic
1108940444 13:55946993-55947015 CTGGTTCTTGTCCCATGACCAGG - Intergenic
1109470707 13:62799979-62800001 CAAGTTCTTGTCCCATGCCCAGG - Intergenic
1109589775 13:64462998-64463020 CGGGTTCTTGTCTGGTGTCCAGG - Intergenic
1109638909 13:65161232-65161254 CAGGTTCTCGTCTCATGACCTGG + Intergenic
1109831158 13:67790945-67790967 CAAGTTTTTGTCTCATGACCCGG + Intergenic
1109863607 13:68232720-68232742 TAGGTTCTTGTCACACAACCAGG + Intergenic
1109892148 13:68629885-68629907 CAAGTTCTTGTTTCATGACCAGG + Intergenic
1109924043 13:69110298-69110320 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1109955182 13:69556820-69556842 CAGGTTTTTGTCACACAACCAGG + Intergenic
1110508139 13:76314495-76314517 CCGGTTCTTGTCACACGACAAGG + Intergenic
1111227352 13:85291049-85291071 CAGGTTCATGGCTCATGGCCGGG - Intergenic
1111268887 13:85854150-85854172 CCAGTTCTTGTCCCATGTCCAGG - Intergenic
1111994127 13:95146297-95146319 CAGGTACTTTGCTCATTACCTGG + Intronic
1112206716 13:97331350-97331372 CAGATTCTGGTCTCATAACTTGG - Intronic
1112260668 13:97875218-97875240 CGGGTTCTTGTCACAAGATCAGG + Intergenic
1112261490 13:97881936-97881958 CAGGTTCTTGTCTGGTGTCCAGG + Intergenic
1112343785 13:98574324-98574346 CTTTTTCTTGTCTCCTGACCAGG - Intronic
1112515669 13:100050819-100050841 CAGGATCTTGTTTTATGATCAGG - Intergenic
1112556307 13:100471933-100471955 CAGGTTCTTGTCTCAGGACTGGG + Intronic
1113289216 13:108886413-108886435 CAGGTTCTTGCCTCACGACCTGG + Intronic
1113972857 13:114203522-114203544 TGGGTACTTGTCACATGACCAGG + Intergenic
1114951493 14:27760537-27760559 CAGGTTCTTCTCTCAACACATGG - Intergenic
1115898449 14:38117797-38117819 CTGGTTCTTGTCTCATGACCAGG - Intergenic
1116102833 14:40464301-40464323 CGGGTTCTTGTCTTATGACCAGG - Intergenic
1116103520 14:40470522-40470544 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1116159706 14:41253279-41253301 TGAGTTCTTGTCTCATGTCCAGG + Intergenic
1116256384 14:42562013-42562035 CGGGTTCTTGTCACATGTCCAGG + Intergenic
1116369258 14:44109040-44109062 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1116493480 14:45534109-45534131 CAGGTTCTTTCCTCAACACCTGG + Intergenic
1116679577 14:47948969-47948991 CAGGTTCTTATCACACGACCAGG + Intergenic
1117385898 14:55212554-55212576 CGAGTTATTGTCTCATGACCAGG + Intergenic
1117601416 14:57379705-57379727 CAGGGTCTTGTCTCTTATCCAGG - Intergenic
1117648397 14:57877105-57877127 CAGGTACTAGGCTCATGACCTGG - Intronic
1118474591 14:66104893-66104915 TGGGTTCTTGTCACACGACCAGG - Intergenic
1118486932 14:66223335-66223357 TGGGTTCTTGTCACATGACCAGG + Intergenic
1118952504 14:70447153-70447175 CAGGTTTCTGTCTCACAACCAGG + Intergenic
1118999051 14:70864986-70865008 CAGGTTCTTGTCTCACAACCAGG + Intergenic
1118999904 14:70872426-70872448 AGAGTTCTTGTCTCATGACCAGG + Intergenic
1119588827 14:75865417-75865439 CAGGTCCTTGGCTCATTACCTGG + Intronic
1119672863 14:76532816-76532838 CAGGGTCTTGTCTGTTGCCCAGG + Intergenic
1120811550 14:88808724-88808746 CAGATTCTTGTCACATAACCAGG + Intergenic
1122386030 14:101348876-101348898 CAGGGTCCTGTCTCATGTCTGGG + Intergenic
1122641485 14:103162325-103162347 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1122954618 14:105064862-105064884 CAGGATCTTGTCACGTGACTGGG + Intronic
1123123699 14:105929797-105929819 CAGGTTCTTTTCTCGTGAGAGGG - Intronic
1123406334 15:20021288-20021310 CAGGTTCTTTTCTCATGAGAGGG - Intergenic
1123479697 15:20619773-20619795 GAGGGTTTTGTCTCATAACCTGG + Intergenic
1123515664 15:21027936-21027958 CAGGTTCTTTTCTCATGAGAGGG - Intergenic
1123638309 15:22380591-22380613 GAGGGTTTTGTCTCATAACCTGG - Intergenic
1123777622 15:23596629-23596651 CAGGTTCTTGTCACATAACCAGG + Intronic
1123888096 15:24748010-24748032 CAGGTTCTTGTCCCACGACCAGG + Intergenic
1124578520 15:30930540-30930562 CAGGATCTTGTCTCCTGCCTGGG + Exonic
1125241608 15:37582743-37582765 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
1125752427 15:42037559-42037581 CAAGTTCTTGTCCTGTGACCAGG - Intronic
1126011515 15:44307169-44307191 CAGGGACTTGTCTCATAAGCTGG + Intronic
1126068149 15:44842146-44842168 GAGTTCTTTGTCTCATGACCAGG - Intergenic
1126090690 15:45048676-45048698 GAGTTCTTTGTCTCATGACCAGG + Intronic
1126156823 15:45573796-45573818 CAAGTTCTTGTCCTATGTCCAGG + Intergenic
1126666184 15:51077956-51077978 GGGGTTCTTGTCACATGACCAGG - Intronic
1126990796 15:54373817-54373839 CAAGTTCTTGTCTCACATCCAGG + Intronic
1127016590 15:54695482-54695504 CAGGTTCTTGTCATATGACCAGG - Intergenic
1127214616 15:56811169-56811191 TGGGTTCTTGTCTCACAACCAGG - Intronic
1128101805 15:65007270-65007292 TGGGTTCTTGTCTCACAACCAGG - Intronic
1128732018 15:70027501-70027523 GAGGTTCTTTTCTCATAACCAGG + Intergenic
1128847922 15:70917809-70917831 CAGGTTCTTGTCCTGCGACCAGG - Intronic
1128920150 15:71603185-71603207 CAGGTTTTTGTCACACCACCAGG + Intronic
1128964146 15:72040574-72040596 TGGGTTCTTGTCACACGACCAGG - Intronic
1129925852 15:79364020-79364042 CAGGTTCTTGTCTCACAACCAGG + Intronic
1130787326 15:87114682-87114704 CAGGTTCTTGTCTAGCGTCCAGG - Intergenic
1130867135 15:87942650-87942672 CAGGTGCTTGCTTCAAGACCTGG + Intronic
1130938641 15:88490164-88490186 CAGGGTGATGTCTCATGATCTGG - Intergenic
1132783624 16:1642255-1642277 CAGGCTTGTGTCTGATGACCTGG + Intronic
1133064011 16:3193230-3193252 CAGGATCTTTTGTCATGCCCTGG + Intergenic
1133843923 16:9436801-9436823 TGAGTTCTTGTCTCATGACCAGG - Intergenic
1134492870 16:14708973-14708995 ACGGTTCCTGTCCCATGACCAGG + Intronic
1134498251 16:14748095-14748117 ACGGTTCCTGTCCCATGACCAGG + Intronic
1134582323 16:15380996-15381018 ACGGTTCCTGTCCCATGACCAGG - Intronic
1136733418 16:32440936-32440958 CAGGTTCTTGTCATACCACCAGG - Intergenic
1137588710 16:49680368-49680390 CAAGTTCTTGTCCCATGTCCAGG - Intronic
1137976127 16:53033624-53033646 CAAGTTCTTGTCTCACATCCAGG - Intergenic
1138316540 16:56074936-56074958 CAGGATCTTGTCTGTTGCCCAGG - Intergenic
1138905204 16:61323287-61323309 TGGGTTCTTGTTTCATCACCAGG + Intergenic
1138978777 16:62241246-62241268 CAGGTTCTTGTCTCATAACCAGG - Intergenic
1140639952 16:76960133-76960155 TAGGGTTTTGTCTCATGCCCAGG - Intergenic
1203019665 16_KI270728v1_random:388666-388688 CAGGTTCTTGTCATACCACCAGG + Intergenic
1203038000 16_KI270728v1_random:661824-661846 CAGGTTCTTGTCATACCACCAGG + Intergenic
1142506565 17:367489-367511 CAGGTTCTTTTCACGTGCCCGGG - Intronic
1142506586 17:367623-367645 CAGGTTCTTTTCACGTGCCCGGG - Intronic
1142506615 17:367821-367843 CAGGTTCTTTTCACGTGCCCGGG - Intronic
1142506635 17:367955-367977 CAGGTTCTTCTCACGTGCCCGGG - Intronic
1143315255 17:6027279-6027301 CAGGTCCTAGTCCCATGGCCAGG - Intronic
1143533691 17:7522863-7522885 CAGGTTCTTATCACACGACCAGG + Intergenic
1144143760 17:12377076-12377098 CAGGCTCTTGTCACATGGCCAGG + Intergenic
1144228556 17:13175643-13175665 TGGGTTCTTGTCTCACGACCAGG - Intergenic
1144334057 17:14253304-14253326 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1144376774 17:14650714-14650736 CAGGTTCCCATCTCAGGACCAGG + Intergenic
1145789025 17:27613328-27613350 CAGGTTCTTGTCTCATGACCAGG + Intronic
1145824978 17:27870044-27870066 TGGGTTCTTGTCTCATGACCAGG - Intronic
1146102975 17:30003937-30003959 CAAGTTCTTGTCTCACAACTAGG + Intronic
1146679590 17:34797465-34797487 TAGGTTCCTATCTCATAACCTGG + Intergenic
1147569145 17:41556980-41557002 CAGGTTCTTGTCTGGCGTCCAGG - Intergenic
1147569519 17:41560061-41560083 CAGGTTCTTGTCTGGTGTCCAGG - Intergenic
1147677454 17:42218102-42218124 CTGCTACTTGTCTCATGTCCTGG - Intronic
1149034083 17:52115288-52115310 CTAGGTCTTGTCTCAAGACCAGG - Intronic
1149034728 17:52120908-52120930 CAGGTCCTTGTCTCACAACAAGG - Intronic
1149056829 17:52376530-52376552 CAGGTTCTTGTGTCATGACCAGG - Intergenic
1149102313 17:52921804-52921826 CAGGTTCTTGTCACACAACCAGG + Intergenic
1149762205 17:59242655-59242677 CAGGTTCTTGTCACATGACCAGG + Intronic
1150726907 17:67658589-67658611 CGAGTTCTTGTCTCACAACCAGG - Intronic
1150847485 17:68674506-68674528 CGGGTTCTTCTCTCACAACCAGG + Intergenic
1150939883 17:69681204-69681226 CAGGTACTAGGCTCATTACCTGG - Intergenic
1151922457 17:77167678-77167700 TGGGTTCTTGTCTCATGACCAGG + Intronic
1152148905 17:78586728-78586750 CAGGCTTTTGTCACACGACCAGG - Intergenic
1153246103 18:3073943-3073965 CAGGTTCTTGTCTCACAACCAGG - Intronic
1153577033 18:6532564-6532586 TGGGTTCTTGTCTCATAACCAGG - Intronic
1153704609 18:7732997-7733019 TGGGTTTTTGTCTCATGACCAGG + Intronic
1153736881 18:8080335-8080357 CATGTGTTAGTCTCATGACCAGG - Intronic
1154206193 18:12339036-12339058 GATGGTCTTGTCTCCTGACCTGG - Intronic
1154421725 18:14236356-14236378 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1155768894 18:29672377-29672399 AAGGTTCCAGTGTCATGACCAGG - Intergenic
1156782422 18:40866654-40866676 TGGGTTCTTGTCACACGACCGGG - Intergenic
1156972324 18:43171110-43171132 CAGGTACTTATTACATGACCAGG - Intergenic
1156993724 18:43440623-43440645 CAAGTTCTTGTCTCACAACCAGG - Intergenic
1157777807 18:50409973-50409995 TTAGTTCTTGTCACATGACCAGG + Intergenic
1158335017 18:56406707-56406729 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1158639207 18:59189011-59189033 CAGGTTCTTATCTCACGACCAGG + Intergenic
1159308616 18:66678798-66678820 CAGGTACTTGTCTCATGACCAGG + Intergenic
1159309204 18:66686544-66686566 CAGGTTCTTATCTCACGACCAGG - Intergenic
1159431213 18:68356254-68356276 CAAGCTCTCGTCTCATGTCCAGG - Intergenic
1159539348 18:69755799-69755821 CAGGTTCTTGTCTCACAACCAGG + Intronic
1159929715 18:74297994-74298016 CATGTTCCTGTCTCATTAACAGG - Intergenic
1163217680 19:15892980-15893002 CAGGGTCATGTCTCATGTCCAGG - Intronic
1163227724 19:15976589-15976611 AAGGTTCTTGTCTCATGCCAGGG + Intergenic
1164810822 19:31154501-31154523 CAGGTTCCTGTCACATGACCAGG + Intergenic
1165354469 19:35295220-35295242 CAGGGTCTTGTTTCATTGCCCGG - Intronic
1166897536 19:46033287-46033309 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
1167758555 19:51428442-51428464 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1202640850 1_KI270706v1_random:84772-84794 TGGGTTCTTCTCTCGTGACCAGG - Intergenic
926046124 2:9710939-9710961 CAGGTCCTTGGCTCTTGGCCAGG - Intergenic
926239182 2:11071644-11071666 CAGGTTCTTGTCACATGACCAGG - Intergenic
926888925 2:17622669-17622691 CAGGCTCTTGTCATATGACCAGG + Intronic
926936858 2:18094612-18094634 CAGCTGCTTATCTCATAACCAGG - Intronic
927474267 2:23400501-23400523 CAGTATCTTATCTCATGACATGG + Intronic
927847254 2:26477913-26477935 CAGGTTCTGTTCTCAGAACCTGG + Intronic
928276850 2:29909130-29909152 CTAGTTCTTGTATCATGGCCAGG - Intronic
928833407 2:35516777-35516799 TGGGTTCTTATCTAATGACCAGG + Intergenic
928834186 2:35523123-35523145 CAGGTTCTTGTCTAACGACCAGG + Intergenic
929237989 2:39626650-39626672 CGGGTTCTTGTGTCACGACCAGG + Intergenic
929652143 2:43691185-43691207 TGGGTTCTTGTCTCACGACCAGG + Intronic
929662433 2:43800997-43801019 CAGTCTCTTGTGTCTTGACCAGG + Intronic
930630723 2:53752285-53752307 CGGGTTCTTGTGTCACCACCAGG + Intronic
931057292 2:58487039-58487061 TGGATTCTTGTCTCATGACCAGG + Intergenic
931471009 2:62537582-62537604 CAGGTTCTTGTAACACGACCAGG - Intergenic
932046735 2:68357577-68357599 CGGATTCTTGTCACACGACCAGG + Intergenic
932394571 2:71432521-71432543 TAGGTTCTTATCTAATGACTTGG + Intronic
933042643 2:77487976-77487998 CAAGTTCTTGTCGCAAGTCCAGG - Intronic
933056664 2:77679324-77679346 CAGATTCTTGTCTCACAACCAGG + Intergenic
933061828 2:77747619-77747641 TGGGTTCTTGTCACATGACTGGG - Intergenic
933310264 2:80652028-80652050 CAGGTTCTTGTCACACGACCAGG + Intergenic
933333604 2:80926158-80926180 TAGGTTCTTGTCTAATGACCAGG + Intergenic
933534854 2:83558560-83558582 CAGGTTCTTGTCTCATGTCCAGG - Intergenic
933870006 2:86556915-86556937 CAGGTACTTGTTTCATGGACAGG - Intronic
933926796 2:87100466-87100488 CAGATTCTTGTCTCACAACCAGG + Intergenic
934496415 2:94804760-94804782 TGGGTTCTTCTCTTATGACCAGG - Intergenic
934932406 2:98437164-98437186 CTGGTTCTTGTCACAAGACCAGG - Intergenic
935377482 2:102414128-102414150 TAGGTTTTTGTCTCATAACGAGG - Intergenic
935704619 2:105845046-105845068 CAGGTTCTTGTCCCTAGAGCGGG + Intronic
935918650 2:107986289-107986311 CAGGTACTTGTCTCAGGATGGGG + Intergenic
935963008 2:108445649-108445671 TGGGTTCTTTTCTCATGACCAGG - Intergenic
936271668 2:111053920-111053942 CTAGCTCTTGTCTCCTGACCTGG - Intronic
936832084 2:116659123-116659145 CCAGTTCTTGTCTCATGACCAGG + Intergenic
936905509 2:117531655-117531677 CAGGTACTAGGCTCATTACCAGG + Intergenic
937035682 2:118779782-118779804 CAGGTTCTTGACTGTTTACCAGG - Intergenic
938198411 2:129352989-129353011 CAGGGTCTAGCCTCCTGACCTGG - Intergenic
938339626 2:130526930-130526952 CAGGGTCTTGGCTAATGCCCTGG - Intronic
938350210 2:130593820-130593842 CAGGGTCTTGGCTAATGCCCTGG + Intronic
939017578 2:136920160-136920182 CAAGTTCTTGTCCCATGTTCAGG + Intronic
939084905 2:137707734-137707756 CAAGTTCTTGTCCTATGTCCAGG + Intergenic
939356746 2:141112141-141112163 TGGGTTCTTGTCTCATGACCAGG - Intronic
939356896 2:141114336-141114358 CAGGTCCTTGTCTGGTGGCCAGG + Intronic
939384290 2:141475933-141475955 CAGGTTCTTGTCTGGTGTCCAGG - Intronic
939393178 2:141594267-141594289 CAAGTTCTTGTCTCACAACCAGG - Intronic
939419156 2:141943820-141943842 CGGGTTCTTGTCACACGACCAGG + Intronic
939460124 2:142488398-142488420 CAAGTTCTTGTCTGGTGTCCAGG - Intergenic
940391124 2:153133549-153133571 CGGGTTCTTGTCACACAACCAGG - Intergenic
940659994 2:156534014-156534036 CAGGTTCTTGTCTGGTATCCAGG + Intronic
940711143 2:157164905-157164927 GAGGTTCTTGTCCTATGTCCAGG + Intergenic
941200040 2:162496618-162496640 TGGGTTCTTGTCTCATGACCAGG - Intronic
941262553 2:163316060-163316082 CAGGTTTTTGTCTCACAACCAGG + Intergenic
941929152 2:170923792-170923814 CAAGTTCTTGTCCCATATCCAGG + Intergenic
942044267 2:172090348-172090370 CAGGTTCCTGCCTAATGATCCGG + Intergenic
942619724 2:177834160-177834182 TGGGTTCTTGTCTCATGACCAGG - Intronic
942867993 2:180699246-180699268 CAAGTTCTTGTCCCATGTCCAGG + Intergenic
943023418 2:182601543-182601565 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
943149828 2:184097939-184097961 CATGTTCTAGTCTCAAGACCAGG - Intergenic
943566237 2:189520144-189520166 CAGGTACTTATCTCCTGGCCAGG - Intergenic
943846503 2:192655884-192655906 CAGGTTCTTGTCACACGACCAGG + Intergenic
943928448 2:193819297-193819319 CAAGTTCTTGTCCCGTGTCCAGG + Intergenic
944022637 2:195125271-195125293 AAAGTTCTTGTCCCATGTCCTGG + Intergenic
944198570 2:197081291-197081313 TAGGTTCTGCTCTTATGACCTGG - Intronic
944243682 2:197510425-197510447 CAGGTTCTTGTCTGTCGCCCAGG + Intronic
944672476 2:202006584-202006606 CAGGTTTCTGTCTCATCACATGG - Intergenic
944960085 2:204862765-204862787 CAGGTTCTTGTCACACGACCAGG + Intronic
944964429 2:204914302-204914324 GGGGTCCTTGTCACATGACCAGG - Intronic
945369828 2:209003372-209003394 CAAGTTCTTGTCTCACAACCAGG - Intergenic
945468661 2:210201312-210201334 TGGGTTCTTGTCACAGGACCAGG - Intronic
945989407 2:216381405-216381427 CAGGATGCTGTCTCATAACCTGG + Intergenic
946652924 2:221913707-221913729 CAGGTTCTTGTCACATGACCAGG + Intergenic
946859438 2:223986613-223986635 CAGGTCCTTATTTCATGCCCTGG - Intronic
946873764 2:224108123-224108145 CTGGTTCTTGTCACATGACCAGG + Intergenic
947136225 2:226979266-226979288 TAGGTTCTTGTCACACAACCAGG + Intronic
948334875 2:237200121-237200143 CAAGTTCTTGCCCCATGTCCAGG + Intergenic
948748655 2:240114102-240114124 CAGGTTTCTGTCTCTTGACCTGG - Intergenic
1169940683 20:10933966-10933988 CAGCTTCTTGTCACATGACCAGG + Intergenic
1170220606 20:13937584-13937606 CAGGTTCTTGTCACACGACCAGG - Intronic
1170244453 20:14205296-14205318 TGGTTTCTTGTCTCATGACCAGG + Intronic
1170335718 20:15267989-15268011 TGGGTTCTTGTCACATGACCAGG - Intronic
1170944129 20:20874826-20874848 CAAGTTCTATTCTCTTGACCTGG - Intergenic
1170946970 20:20900257-20900279 CTGGTTTTTATCTCATGACCAGG + Intergenic
1170948037 20:20909587-20909609 CGGGTTCTTGTCACACGGCCGGG + Intergenic
1171877856 20:30594936-30594958 CAGGTTCATGTCACATTGCCAGG + Intergenic
1171887727 20:30671521-30671543 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1171933299 20:31248146-31248168 CAGGTTTTTGTTACATAACCAGG + Intergenic
1172365232 20:34343950-34343972 CAGGTCCTTGTCACACAACCAGG - Intergenic
1172758244 20:37302936-37302958 CAGGGTCTTGTCTGTTGCCCAGG + Intronic
1173315916 20:41942932-41942954 CCTGTTTGTGTCTCATGACCTGG + Intergenic
1173820867 20:46019556-46019578 CAGCCTCTTGTTTCTTGACCTGG - Intergenic
1173884494 20:46445543-46445565 CAAGTTCTTGTCCTATAACCAGG + Intergenic
1174544098 20:51312360-51312382 AGGGTTCTTGTCACATGACCAGG + Intergenic
1175027779 20:55921246-55921268 CTGGTTCTTGTCTCATACCCAGG + Intergenic
1175716062 20:61254355-61254377 CAGCTTCTTGTCTCCTCTCCAGG - Intronic
1176851759 21:13923604-13923626 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1176907530 21:14520950-14520972 TGGGTTCTTGTCACACGACCAGG - Intronic
1177105242 21:16946589-16946611 CAGGACATTGACTCATGACCTGG + Intergenic
1177172193 21:17667215-17667237 CGAGTTCTTGTCTCACAACCAGG + Intergenic
1177404382 21:20646263-20646285 CAAGTTCTTGTCTCACATCCAGG - Intergenic
1177414364 21:20775655-20775677 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1177549511 21:22601673-22601695 CATGTTCTTGTCTCACAACCAGG + Intergenic
1177567347 21:22842867-22842889 CAGGTTCTTGTGTCATAATCGGG + Intergenic
1177878148 21:26659978-26660000 CAAGTTCTTGTCTCATGACCAGG - Intergenic
1177900928 21:26914174-26914196 CGGGTTCTTGTCTCATGACCAGG - Intergenic
1178103532 21:29295654-29295676 CAAGTTCTTGTCTCACAACCAGG - Intronic
1178482700 21:32993438-32993460 CAGGTTTTTCTCACAGGACCTGG - Intergenic
1178803448 21:35818558-35818580 CAGGTTTATGTCTCAGGACTTGG - Intronic
1179140515 21:38721051-38721073 CAGGGTCTTGTCACATGACCAGG + Intergenic
1179474068 21:41632161-41632183 CAGTGGCTTGACTCATGACCTGG + Intergenic
1179558738 21:42198476-42198498 CACATTCTTGTCCCATAACCTGG + Intergenic
1179956221 21:44740643-44740665 TGGGTTCTTGTCCCATTACCAGG - Intergenic
1180153107 21:45962506-45962528 TGGGTTCTTGTGTCATGACCAGG + Intergenic
1180361102 22:11897090-11897112 TGGGTTCTTCTCTCGTGACCAGG + Intergenic
1180539048 22:16424150-16424172 CAGGTTCTTGTCACACCACCAGG + Intergenic
1181435763 22:22909935-22909957 CAGGGTCTTGTCTCATTTCTGGG - Intergenic
1182867750 22:33619140-33619162 TGGGTTCTTGTCTCGTGACCAGG - Intronic
1183759104 22:39799432-39799454 CAGGTTCTTGTCTCATGACCAGG + Intronic
1184704795 22:46203553-46203575 TGGGTTCTTGTGTCATGACCAGG + Intronic
1184754876 22:46510033-46510055 CATGTTCTTGCCTCCTGCCCTGG - Intronic
949095152 3:77084-77106 TGGGTTCTTGTCACATGACCAGG + Intergenic
949166926 3:954224-954246 CTGGTTCTTGTCACACGACCAGG + Intergenic
949785224 3:7733228-7733250 CAGGTTCTTATCTCACAACCAGG + Intronic
950036946 3:9893005-9893027 GAGGCTCTTGTCACATGATCAGG + Exonic
951182228 3:19671962-19671984 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
951303535 3:21028387-21028409 CAGGTTTTTGTCACATGGCCAGG + Intergenic
951879361 3:27465008-27465030 CGGGTTCTTGTCACACGGCCGGG - Intronic
952080084 3:29747620-29747642 TGGGTTCTTTTCTCATGACCAGG + Intronic
952108279 3:30093504-30093526 TGGGTTCTTGTCTCATGACCAGG + Intergenic
952325112 3:32313823-32313845 CATGTTCTTGTCACACGACCAGG + Intronic
952454311 3:33458346-33458368 TGGGTTCTTGTCTCAGGATCAGG + Intergenic
952625041 3:35393260-35393282 TGGGTTCTTGTCTCACAACCAGG - Intergenic
952636989 3:35544890-35544912 TGGGTTCTTGTCACATGACCAGG + Intergenic
953337069 3:42102515-42102537 AAGGTTCTTGTCTCATGACCAGG + Intronic
953441092 3:42918232-42918254 TGGGTTCTTGTCTCATGACCAGG + Intronic
953603119 3:44387329-44387351 CAAGTTCTTGTCCCATGTCCAGG - Intronic
953647439 3:44768346-44768368 CAAGTTCGTGTTGCATGACCAGG + Intronic
953648094 3:44773814-44773836 CAGGTTCTTGTCGCATGACCAGG + Intronic
954692259 3:52401847-52401869 CAGGTCCTTGTATCATGCCACGG - Exonic
955578972 3:60398102-60398124 CGAGTTCTTGTCTCACAACCAGG - Intronic
955733372 3:62010908-62010930 CAGGTTCTTGTCTCATGACCAGG + Intronic
955934569 3:64090320-64090342 TGGGTTCTTGTCTCACCACCAGG - Intergenic
956541460 3:70344522-70344544 CAGGTCCTTGTCTGGTGTCCAGG - Intergenic
957028248 3:75209457-75209479 CAGGTTCTTGTCACATGACCAGG - Intergenic
957236720 3:77602498-77602520 CAGGTTCTTGTGTCCTGAGGAGG + Intronic
957266268 3:77970168-77970190 CAGGATCTTGTCTCAAAAACAGG + Intergenic
957287768 3:78239141-78239163 CAGGTTCTTGTCCAGTGTCCAGG - Intergenic
957459350 3:80497055-80497077 CAAGTTCTTGCCTCATATCCAGG + Intergenic
957991894 3:87636592-87636614 CAGGTTCTTGACTCATGACCAGG - Intergenic
958047986 3:88308058-88308080 CAGATTCTTGTCATATGACCAGG - Intergenic
958527390 3:95280689-95280711 TGGGTTCTTGTCTCACAACCAGG - Intergenic
958536217 3:95408028-95408050 CAGGTTCTTATCACATGACCAGG - Intergenic
958536722 3:95412890-95412912 TCGGTTCTTGTCACATGACCAGG - Intergenic
958572882 3:95911177-95911199 CAAGTTCTTGTCCTCTGACCAGG + Intergenic
959158177 3:102692645-102692667 TGGGTTCTTGTCCCATGACCAGG + Intergenic
959429661 3:106236857-106236879 CAGGTTCTTGTCTCACGATCAGG - Intergenic
959486808 3:106936231-106936253 CCAGTTCTTGTCACATGACCAGG + Intergenic
959574056 3:107914971-107914993 TGGTTTCTTGTCACATGACCAGG - Intergenic
959660573 3:108863722-108863744 CGGGTTCTTGTCACATGACCAGG + Intergenic
959685354 3:109140221-109140243 CAGGTTCTTGTCATGTGACCAGG + Intergenic
960857659 3:122119777-122119799 CAGCTTAATGGCTCATGACCTGG + Exonic
962582572 3:136811684-136811706 CAGCGTATTGTCTCATGACCAGG + Intergenic
962824473 3:139088035-139088057 CAAGTTCTTGTCTTGTGCCCAGG + Intronic
963346327 3:144099692-144099714 CAAGTTCTTGTCCCATGCCCAGG - Intergenic
963435439 3:145259820-145259842 TAGGTTCTTGTCTCAATACTAGG + Intergenic
964133264 3:153314889-153314911 CAAGTTCTTGTCTCACAACCAGG + Intergenic
964314261 3:155426696-155426718 TGGGTTCTTGTCTCATGACAAGG + Intronic
964362036 3:155908463-155908485 CGGGTTCTTTTCACATGACCAGG - Intronic
964954238 3:162333023-162333045 GAGGATCTTCTCTGATGACCAGG + Intergenic
965117859 3:164515062-164515084 CCAGTTCTTGTCCCATGTCCTGG + Intergenic
965178471 3:165367247-165367269 TGGGTTCTTGTCCCATGACCAGG + Intergenic
965367822 3:167821157-167821179 CAGGTTCTTGTCTCACATCCAGG - Intronic
966143817 3:176787485-176787507 CAGATTCTTGTTTTAAGACCAGG + Intergenic
967186338 3:186947958-186947980 CAGTTTCTTGCCTGTTGACCAGG - Intronic
967546197 3:190731847-190731869 CAGGTTCTTGTCACACAACCAGG + Intergenic
967649820 3:191973090-191973112 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
967761125 3:193227425-193227447 CAGGTTCTTGTCACACAACCAGG - Intergenic
967763150 3:193247564-193247586 TGGGCTCTTGTCTCATGACCAGG - Intronic
968381592 4:101286-101308 TGGGTTCTTGTCACATGACCAGG - Intergenic
968393402 4:211655-211677 CAGGCTCTCGTCCCATGACCTGG - Intergenic
968538582 4:1150620-1150642 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
968838278 4:2981311-2981333 CAAGTTCTTGTCCCATGTCCAGG + Intronic
969073775 4:4561011-4561033 CAGGCTCTTGTCACACGACCAGG + Intergenic
969610539 4:8225506-8225528 TGGGTTCCTTTCTCATGACCTGG + Intronic
969884201 4:10200778-10200800 CAGGTGCTTTTCTTATGACCTGG + Intergenic
969903497 4:10371776-10371798 TAGGTTCTTTTTACATGACCAGG + Intergenic
970729920 4:19090578-19090600 CAGATTCTTGTCACATGACCAGG - Intergenic
971167289 4:24197235-24197257 CAGGTTGTTATTTCATGCCCTGG - Intergenic
971572436 4:28230406-28230428 AGGATTCTTGTCACATGACCAGG - Intergenic
971669767 4:29542285-29542307 CAAGTTCTTGTCTCATGTCCAGG + Intergenic
971876787 4:32318531-32318553 CAACTTCTTGTCTCATGTCCAGG + Intergenic
971927908 4:33037883-33037905 CAGGTTCTTGTCACAGGACCAGG - Intergenic
972108152 4:35519996-35520018 CAGGTTATTGTCTCATGATCAGG + Intergenic
972930972 4:44071342-44071364 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
973193108 4:47409270-47409292 CAGGTTCTTGTCTGGAGTCCAGG + Intronic
973238596 4:47932710-47932732 CAAGTTCTTGTCTCATGACCAGG + Intronic
973384366 4:49495303-49495325 TGGGTTCTTCTCTCATGACCAGG - Intergenic
974174962 4:58309898-58309920 CAAGTTCTTGTCTGGTGTCCAGG + Intergenic
974421575 4:61683352-61683374 CAAGTTCTTGTCTCACAACCAGG + Intronic
974610109 4:64206025-64206047 CAGGTTCTTGTCTGGTGTCCAGG + Intergenic
974848106 4:67375989-67376011 CAGGTTCTGATCTCAACACCTGG - Intergenic
975008545 4:69321196-69321218 CAAGTTCTTGTCTTGTGACCAGG - Intronic
976461858 4:85320935-85320957 CAAGTTCTTGTCTCATGACCAGG + Intergenic
976751538 4:88455263-88455285 CAGGTTCTTGTCTCATGACCAGG + Intergenic
976778023 4:88727761-88727783 CAGGCTCTTCTCCCATGACCTGG + Exonic
976862455 4:89681618-89681640 CGGGTTCTTGTCTAACAACCAGG - Intergenic
977254702 4:94727763-94727785 CAGGTTCTTGTCTGGTGTCCAGG - Intergenic
977823461 4:101502803-101502825 CAGGCTCTTGTCACATGACCAGG - Intronic
977907223 4:102491290-102491312 GAGTTTTTTGTCTCATGAACAGG - Intergenic
978328474 4:107586254-107586276 TGGGTTCTTGTCACATGACCAGG + Intergenic
978355125 4:107863972-107863994 CAGGTTCTTGGCTAGTGGCCAGG + Intronic
978749334 4:112229318-112229340 CAGGTTCTTGTCACATGACAAGG - Intergenic
979053668 4:115969737-115969759 CTGGTTCTTGTCTCACAACTAGG + Intergenic
979090518 4:116477606-116477628 CAAGTTCTTGTCCCATGTGCAGG + Intergenic
979136714 4:117119035-117119057 CAAGTTCTTGTCCCACGTCCAGG + Intergenic
979462920 4:121003866-121003888 CAAGTTCTTGTCCTATGACCAGG - Intergenic
979609383 4:122673274-122673296 CAGTTTCTTGTCACTTGACCAGG + Intergenic
979624912 4:122834006-122834028 CTGGTTCTTGTCACACGCCCAGG + Intronic
980046930 4:127999549-127999571 CAGGTACTATGCTCATGACCTGG + Intronic
980287477 4:130799160-130799182 CGGGTTCTTGTCTCACAACCAGG + Intergenic
980541761 4:134204368-134204390 CAGGGTCTTGCCTGTTGACCAGG + Intergenic
980795479 4:137677005-137677027 CTGGTTCTTGTGTCACAACCAGG + Intergenic
980984515 4:139682781-139682803 TGGGTTCTTGTCACATGGCCAGG + Intronic
981297321 4:143147041-143147063 CAAGTTCTTGTCTGGTGTCCAGG - Intergenic
981456007 4:144954019-144954041 CAGGTTCTTGTCACACGACCAGG - Intergenic
981456904 4:144962880-144962902 CAGGTTCTTGTCATATGAACAGG - Intergenic
981491151 4:145340704-145340726 CAGGTTCTTGTCACATGACCAGG - Intergenic
981764211 4:148229409-148229431 CAGGTTCTGATCTCATGACCAGG - Intronic
981770783 4:148304977-148304999 TGGGTTCTTGTGTCATGACCAGG - Intronic
981824740 4:148927029-148927051 CAGCTCCATGTCTCAAGACCTGG + Intergenic
982157984 4:152540085-152540107 CAAGTTCTTGTCCCGTGACCAGG + Intergenic
982475253 4:155842778-155842800 TGGGCTCTTGTCACATGACCAGG + Intronic
982521172 4:156418103-156418125 TGGGTTCTTGTCTCATGACCAGG - Intergenic
982526670 4:156487528-156487550 TGGGATCTTGTCTCACGACCTGG - Intergenic
982614317 4:157621829-157621851 TAAGTTATTGTCTCAAGACCTGG + Intergenic
982856165 4:160385298-160385320 CAAATTCTTGTCCCATGTCCAGG + Intergenic
982863117 4:160479436-160479458 CAGGTTCTTGTCTCAAGACCAGG + Intergenic
983040660 4:162921534-162921556 CGGGTTCTTGTCACATGACAAGG - Intergenic
983040672 4:162921616-162921638 CAGGTTCTTATCACATGACCAGG - Intergenic
983403424 4:167294948-167294970 CCGGTTCTTGTCTCACAAGCTGG + Intergenic
983431051 4:167652068-167652090 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
983502292 4:168512951-168512973 CAGGTACTAATCTCATTACCTGG + Intronic
983552707 4:169033652-169033674 CAGGTTCTTGTCACACGACCAGG + Intergenic
983686880 4:170420836-170420858 TGGGTTCTTGTCTCACAACCAGG - Intergenic
983705096 4:170648139-170648161 TGGCTTCTTGTCTCATGACCAGG + Intergenic
984099757 4:175471436-175471458 AGGGTTCTTGTCACACGACCAGG + Intergenic
984118473 4:175711896-175711918 ACTGTTCTTGTCACATGACCAGG - Intronic
984219077 4:176951582-176951604 CAGGTTCTTGTCACACAACAAGG + Intergenic
984327357 4:178271195-178271217 CAGGTTCTTGTTTCATGACCAGG - Intergenic
984337902 4:178415778-178415800 CTAGTTCTTGTCCCATGTCCAGG - Intergenic
984534771 4:180960640-180960662 CAGGTGTTTGTCTCATGCCTGGG - Intergenic
984763868 4:183384778-183384800 CAAGTTCTTGTCCCACGTCCAGG - Intergenic
984870673 4:184322287-184322309 CAGGTACTATTCTTATGACCTGG - Intergenic
985227445 4:187777918-187777940 CAGGCTCTTGTCCCATGACAAGG + Intergenic
1202768217 4_GL000008v2_random:170627-170649 TGGGTTCTTCTCTCGTGACCAGG - Intergenic
985916262 5:2921197-2921219 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
985919926 5:2962472-2962494 CTGGTTCTTGTCTCATGACCAGG + Intergenic
986683574 5:10255601-10255623 CACGTTTTAGTCTCATCACCAGG + Intronic
986860125 5:11917795-11917817 CAGGGTCTTGTCTCAATGCCTGG - Intergenic
987358357 5:17084520-17084542 CGGGTTCTTGTCTCACGACCAGG + Intronic
987570743 5:19654691-19654713 CAGGTTCTTGTCTGGTGTCCAGG + Intronic
987875462 5:23675228-23675250 CAAGTTCTTGTCACATGTCCAGG - Intergenic
988069867 5:26274028-26274050 CAGGTTCTCGTCTCATGACGAGG - Intergenic
988157900 5:27477915-27477937 TAGGTTCTCGTCACATGACCAGG - Intergenic
989438179 5:41438678-41438700 TGGGTTCTTGTCACATGACAAGG - Intronic
989578166 5:43007965-43007987 CGGGTCCTTGTCTCACGATCAGG - Intergenic
989715076 5:44453730-44453752 CAGGTTTTTGTTACATGACCAGG + Intergenic
989715572 5:44458475-44458497 CGGGTTTTTGTCACATGACCAGG + Intergenic
989719143 5:44504116-44504138 CAGGTCCTTGTCTGGTGTCCAGG - Intergenic
990079828 5:51899397-51899419 CAAATTCTTGTCTGGTGACCAGG + Intergenic
990176959 5:53118728-53118750 CAGGTTCTTGTTTCATGACCAGG + Intergenic
990569949 5:57068043-57068065 CAGGTTCTTTTCTCATGACCAGG - Intergenic
991082991 5:62621255-62621277 CAGGTTCTTGTCACACGACCAGG + Intronic
991207469 5:64065995-64066017 CAGGTCCTTGTCTAGTGTCCAGG - Intergenic
993703301 5:91143362-91143384 CAAGTTCTTGTCCCATGCCCAGG + Intronic
993728664 5:91397134-91397156 TTGGTTCTTGTCACATGACCAGG + Intergenic
994453943 5:99981394-99981416 CAGGTTCTTTTCTCGCGACCAGG - Intergenic
994913115 5:105938972-105938994 TGGGTTCTTGTCACATGACCAGG + Intergenic
994948128 5:106423058-106423080 CGAGTTCTTGTCCCATGTCCAGG - Intergenic
995863039 5:116661605-116661627 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
995927071 5:117386845-117386867 CGAGTTCTTGTTCCATGACCAGG - Intergenic
996677054 5:126188285-126188307 CGAGTTCTTGTCACAGGACCAGG - Intergenic
996955389 5:129177393-129177415 CAGGTTCTTGTCTCACAACCAGG + Intergenic
998641147 5:144012814-144012836 CAGGTTCTTGTCACATGAGTAGG + Intergenic
998856400 5:146398995-146399017 CAAGTTCTTGTCTGGTGTCCAGG - Intergenic
998942989 5:147305156-147305178 TGGGCTCTTGTCACATGACCAGG + Intronic
1000234428 5:159344456-159344478 CAGGTTCTTGTCCTATGTCCAGG + Intergenic
1000241841 5:159415942-159415964 CGGGTTCTTGTCACACAACCAGG - Intergenic
1000675652 5:164119756-164119778 TAGGATCTTGTCACATGACTAGG + Intergenic
1000740810 5:164968378-164968400 CAGGTTATTGCCTCAAGACCGGG + Intergenic
1000741631 5:164975924-164975946 CAGGTTCTTGTCTCACAATCAGG + Intergenic
1001902057 5:175440295-175440317 CAGGTTCCTGCATCATCACCCGG - Exonic
1002480559 5:179498143-179498165 CAGGCTCATGGCTCACGACCTGG + Intergenic
1002677977 5:180934896-180934918 CAAGTTCTTGTCCCATATCCAGG + Intronic
1002762673 6:214148-214170 CAGGTCCTTGTCCCATGTCCAGG - Intergenic
1002764979 6:231588-231610 CAGATTCTTCTCTGATGCCCTGG + Intergenic
1003193998 6:3898908-3898930 CAGGTTCTTGTTTGGTGTCCAGG + Intergenic
1005055176 6:21722478-21722500 CAGGTTCTTGTCACACAACCAGG + Intergenic
1005309751 6:24548219-24548241 CAGGCTCTTGTCACACTACCAGG + Intronic
1005564680 6:27079009-27079031 CGGGTTCTTGTCACATAACCAGG - Intergenic
1005796660 6:29370031-29370053 CAGGTACTAGGCTCATTACCAGG - Intronic
1005981540 6:30840615-30840637 CGGGTTCTTGTCACATGACCAGG + Intergenic
1005981969 6:30843614-30843636 CAGGTTCTTGTCACACAAGCAGG - Intergenic
1007281067 6:40712932-40712954 CAGGATCTCATCTCAAGACCTGG + Intergenic
1007666773 6:43518569-43518591 CAGGTTCTTGTCTCTCTCCCAGG - Intronic
1008981749 6:57491695-57491717 TGGGTTCTTGTCTCACCACCAGG + Intronic
1009735950 6:67675731-67675753 TGAGCTCTTGTCTCATGACCAGG + Intergenic
1009846847 6:69145589-69145611 CAAGTTATTGTCCCATGTCCAGG + Intronic
1010534639 6:77011945-77011967 CAAGTTCTTGTCTCATGTTCAGG - Intergenic
1010809723 6:80287527-80287549 CAGGTTCTTGTCTCCCAACCAGG + Intronic
1010872995 6:81064526-81064548 CGGGTTCTTGTCACACGACCAGG + Intergenic
1010887548 6:81263163-81263185 CAAGTTCTTGTCCCATGTCCAGG + Intergenic
1010992081 6:82490468-82490490 TGGGTTCTTGTCTCACAACCAGG - Intergenic
1011375603 6:86682810-86682832 CAGATTCTTCTCCCATGATCTGG + Intergenic
1011882414 6:92045982-92046004 AAGGTTCTTGTCACAGTACCAGG - Intergenic
1011948503 6:92936040-92936062 AAGGTTCTGCTTTCATGACCTGG - Intergenic
1012143319 6:95650585-95650607 TGTGTTCTTGTCTCATGATCAGG - Intergenic
1012595488 6:101032966-101032988 CAGGTTCTTGTCTAATGACCAGG - Intergenic
1012629171 6:101442187-101442209 CAGGTTCTTGTCACAGGACCAGG + Intronic
1012804819 6:103879993-103880015 TAGGTTCTTGTCACGTGACCAGG - Intergenic
1013437388 6:110124440-110124462 CAGGTTCTTGTCTCACGATGAGG - Intronic
1014193499 6:118525091-118525113 TGGGTTCTTGTCACACGACCAGG - Intronic
1014817617 6:125952976-125952998 CAGGTTCTTGTCCCACATCCAGG - Intergenic
1014953849 6:127592890-127592912 CGTGTTCCTGTCACATGACCAGG + Intergenic
1014956340 6:127621514-127621536 TGGGTTCTTGTCTCACGACCAGG - Intergenic
1015195658 6:130522401-130522423 CAGTTTGTTGTCTCTTGACTTGG - Intergenic
1015456929 6:133436848-133436870 CAGGATCATGACTCATTACCAGG + Intronic
1015681437 6:135813161-135813183 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1016210889 6:141531969-141531991 CAAGTTCTTGTTCCATGTCCAGG - Intergenic
1016233177 6:141830894-141830916 TGGGTTCGTGTCACATGACCAGG + Intergenic
1016559295 6:145377447-145377469 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1016618319 6:146078882-146078904 CAGGTTCTTGTCACACCACCAGG + Intronic
1017522292 6:155213183-155213205 CGAATTCTTGTCCCATGACCAGG + Intronic
1017559983 6:155616156-155616178 TGGGTTCTTGTCTCACAACCAGG + Intergenic
1017867946 6:158461041-158461063 CAGGTGTTTGTCACATGACTGGG - Intronic
1018089574 6:160334003-160334025 CAGGTGGTTGTCTCATGTTCAGG + Intergenic
1018089576 6:160334022-160334044 CAGGTGGCTGTCTCATGTCCAGG + Intergenic
1018089585 6:160334078-160334100 CAGGTGGCTGTCTCATGTCCAGG + Intergenic
1019042331 6:169117569-169117591 CAAGTCCTTGTCTGATGTCCAGG - Intergenic
1019434564 7:1015377-1015399 CAAGTCCCTGTCTCATGAACAGG + Intronic
1020025189 7:4894809-4894831 CAGGTTCTTGTTCCGTGTCCAGG + Intergenic
1020596220 7:10211606-10211628 CAGGTTCTTCTCTCACAACCAGG + Intergenic
1020596607 7:10214171-10214193 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1020627469 7:10599681-10599703 CAGGTACTTGTCTCACAGCCAGG - Intergenic
1020955844 7:14739560-14739582 TGGGTGCTTGTCTCATGATCAGG - Intronic
1020956530 7:14745819-14745841 CAGGTTCTTGTCTCATGACCAGG - Intronic
1021021077 7:15599535-15599557 CAATTTCTTGTTTCATGCCCAGG + Intergenic
1021101202 7:16586985-16587007 CAGGTTCTCGTCTCACAACCAGG + Intergenic
1021103624 7:16612031-16612053 CAAGTTCTTGTCTTACAACCAGG - Intronic
1021585334 7:22201810-22201832 AAAGTTCTTGGCTGATGACCAGG + Intronic
1021647672 7:22802308-22802330 CAGGTTTTTGTGTCACAACCAGG - Intergenic
1021648375 7:22808544-22808566 CAGGTTCTTGTGTCATGACCAGG - Intergenic
1021874486 7:25035965-25035987 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1021961273 7:25875415-25875437 CAGATTCTTGTTTCCTAACCTGG - Intergenic
1023488962 7:40717229-40717251 CAGGCTCTTGTCACACGACCAGG + Intronic
1024023031 7:45388063-45388085 CACGTCCTTGTCTCATTGCCAGG - Intergenic
1024438139 7:49382606-49382628 CAGGTTTTTGTTTCACGACCAGG - Intergenic
1024743642 7:52382755-52382777 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1025157912 7:56625986-56626008 TGGGTTCTTGTCACATGACAAGG - Intergenic
1025757817 7:64362038-64362060 TGGGTTCTTGTCACATGACTAGG + Intergenic
1025992157 7:66504432-66504454 CAGGGTCCTGTCTTATGGCCGGG - Intergenic
1026339647 7:69424331-69424353 CAGGATCTGGCCTGATGACCTGG - Intergenic
1026393546 7:69928009-69928031 CAAGTTCTTGTCTCACATCCAGG + Intronic
1027287742 7:76666217-76666239 TGGGTTATTGTCTCATGACCAGG - Intergenic
1028401902 7:90433589-90433611 TGAGTTCTTGTCTCATGTCCAGG + Intronic
1028849770 7:95525029-95525051 TGGGTTCTTGTCACATGACCAGG - Intronic
1029002453 7:97168187-97168209 CAAGTTCTTGTCTCATGACCAGG - Intronic
1030041368 7:105453300-105453322 CAAGTTCTTATGTCATGACCAGG - Intronic
1030114316 7:106051532-106051554 TGGGTTCTTGTCTCACGACCAGG + Intergenic
1030496621 7:110308801-110308823 CAGGTTCTTGTCTCATGACCAGG + Intergenic
1031057651 7:117011078-117011100 AGGGTTCATGGCTCATGACCTGG - Intronic
1031112609 7:117630460-117630482 CGGGTTCTTGTCACATGATCCGG + Intronic
1031174158 7:118328555-118328577 CAAGTTCTTTTCTCATGAACAGG + Intergenic
1031616481 7:123887883-123887905 CAGGCTCTTGACTCATGACCAGG - Intergenic
1032250914 7:130256547-130256569 CAGGTTCTTGTCACAAGACTGGG - Intergenic
1032329223 7:130962276-130962298 TGGGTTCTTGTCACATGACCAGG + Intergenic
1032580050 7:133096079-133096101 TAAGTTCTTGTCACACGACCAGG + Intergenic
1033124532 7:138696248-138696270 CAGGGTCTTGTCTGTTGCCCAGG + Intronic
1033865567 7:145687077-145687099 CAGGTTCTTGTCAGATGACGTGG - Intergenic
1034125977 7:148671982-148672004 TGGGTTCTTGTCTCAGAACCAGG + Intergenic
1034252138 7:149701229-149701251 CCAGTTCTTGTCCCATGTCCAGG + Intergenic
1034450200 7:151133172-151133194 CAGGTTCTTCTCTCAGGAAGGGG + Intronic
1035418407 7:158707690-158707712 CAAGTTCTTGTCCCATGTCCAGG + Intergenic
1035922407 8:3691983-3692005 CAGCATCCTGTCTCATGAGCTGG - Intronic
1036155623 8:6339443-6339465 CAGGTTCTTGCCACACAACCAGG - Intergenic
1037103613 8:15078230-15078252 TGGGTTCTTGTCTCATGACCAGG - Intronic
1037259865 8:16996248-16996270 GAGGTCCTTGTCACATGACCAGG - Intronic
1037412517 8:18613518-18613540 GGGGTTCTTGTCACACGACCAGG - Intronic
1038370298 8:26982146-26982168 CGGGTTCTTGACACATGACCAGG - Intergenic
1039575083 8:38616677-38616699 GTGGTTTTTGTCTCAGGACCTGG + Intergenic
1039701079 8:39962552-39962574 CAGGATCTTGTCTCATGACCAGG + Intronic
1039743219 8:40401022-40401044 TAGGTTCTTGTCTCATAACCAGG + Intergenic
1039802384 8:40970622-40970644 CAGGTTCTTGTCACACAACCAGG + Intergenic
1040373989 8:46805596-46805618 TGGGTTCTTGTCACATGACTAGG + Intergenic
1040374482 8:46810644-46810666 CAGGATCTTGTAACATAACCAGG + Intergenic
1040662959 8:49596747-49596769 CAGGTTCTTGTCTCATGACCAGG - Intergenic
1040853413 8:51925045-51925067 CTGGTTCTTGTTACATAACCAGG + Intergenic
1040919330 8:52599325-52599347 CAGTTTCTTGTCCCATGACCAGG - Intergenic
1040997259 8:53414264-53414286 CAGGCTCTTGTCACACGACCAGG + Intergenic
1041351627 8:56952800-56952822 CAGGTTCTTGTCTCATGACGAGG - Intergenic
1041401272 8:57448041-57448063 CAGGTTCTTGCCACACAACCAGG + Intergenic
1041911945 8:63098065-63098087 TGGGTTCTTGTGTCACGACCAGG - Intergenic
1041965424 8:63669882-63669904 TGTGTTCTTGTCTCATGTCCAGG + Intergenic
1042004967 8:64169765-64169787 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
1042031626 8:64482516-64482538 CAGGCCCTTCTCTCCTGACCTGG + Intergenic
1042427130 8:68661428-68661450 CGGGTTCTTGTCTCACAACCAGG + Intronic
1042442286 8:68842589-68842611 CAGGTTCTTATATCAAGAACTGG + Intergenic
1042471880 8:69199442-69199464 CAGGTTCCTCTCTCAACACCTGG - Intergenic
1042554959 8:70026587-70026609 CGGGTTCTTGTCACACAACCAGG + Intergenic
1043690891 8:83150124-83150146 TGGGTTCCTGTCTCATGACCAGG - Intergenic
1043695261 8:83208968-83208990 CAAGTTCTTGTCCCATATCCAGG - Intergenic
1043734972 8:83730711-83730733 CAAGCTCTTGTCACATGCCCAGG + Intergenic
1044740719 8:95323511-95323533 TGGTTTCTTGTCTCATGACCAGG + Intergenic
1045191541 8:99889063-99889085 TGGGTTCTTGTGTCATGACCAGG - Intronic
1045670953 8:104552971-104552993 CAAGTTCTTTTCCCATGATCTGG - Intronic
1046337791 8:112813024-112813046 CGAGTTCTTGTCACACGACCAGG + Intronic
1046405243 8:113764291-113764313 CAGCTTGTTATCTCAGGACCAGG + Intergenic
1046406255 8:113776225-113776247 TAAGTTCTTGTCTCACAACCAGG - Intergenic
1046412149 8:113859454-113859476 TGGGTTCTTGTCACATGACGAGG - Intergenic
1046508909 8:115173223-115173245 CGGCTTCTTGTCTCACGACCAGG - Intergenic
1047128213 8:121987272-121987294 AAGGTTCTTGTCACACAACCAGG + Intergenic
1048175583 8:132149454-132149476 CGGGTTCTTGTCACATGACCAGG - Intronic
1048643944 8:136396548-136396570 CAGCTTCATCTCTCATGAGCAGG + Intergenic
1049346350 8:142141147-142141169 CAAGGTCTTGTCTCCTCACCTGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049826791 8:144674208-144674230 CAAGTTCCTGTCACATGTCCAGG + Intergenic
1050445777 9:5721289-5721311 CAGGTTCTTGTCACACAGCCAGG + Intronic
1050785275 9:9393137-9393159 CAGGTTCTTGTCACATGGCCAGG - Intronic
1050913145 9:11100311-11100333 CAGGTTCTGGTCTCACAACCAGG + Intergenic
1050928877 9:11300030-11300052 TGGGTTCTTGTCTCACAACCAGG + Intergenic
1050929858 9:11309001-11309023 CGGGTTCTTGTCACATGACCAGG - Intergenic
1051134333 9:13901148-13901170 CCTGTTCTTGTCTCATGCCCAGG - Intergenic
1052059238 9:23940999-23941021 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1052059864 9:23946514-23946536 TGAGTTCCTGTCTCATGACCAGG + Intergenic
1052116059 9:24649495-24649517 CAAGTTCTTGTCCCATGTCCAGG - Intergenic
1052509032 9:29390750-29390772 TGGGTTCTTGTCACATGACCAGG + Intergenic
1052519920 9:29533668-29533690 CAGGTTGTTGTCACAGGACCAGG + Intergenic
1052795374 9:32918993-32919015 CAGTTTCTTGTGACACGACCAGG - Intergenic
1052875622 9:33560147-33560169 TGGGTTCTTCTCTCATGACCAGG + Intronic
1053339406 9:37310222-37310244 CAGGTTCTTGTCTTCTGAAAGGG - Intronic
1053500389 9:38584197-38584219 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1053660729 9:40275687-40275709 TGGTTTCTTCTCTCATGACCAGG + Intronic
1053751864 9:41265532-41265554 CAGGTTCATGTCACATTGCCAGG - Intergenic
1053911107 9:42905032-42905054 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1054257387 9:62829862-62829884 CAGGTTCATGTCACATTGCCAGG - Intergenic
1054333929 9:63785861-63785883 CAGGTTCATGTCACATTGCCAGG + Intergenic
1054361739 9:64128590-64128612 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1054372853 9:64421903-64421925 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1054523881 9:66100597-66100619 TGGTTTCTTCTCTCATGACCAGG - Intergenic
1054680480 9:67911680-67911702 TGGGTTCTTCTCTCATGACCAGG + Intergenic
1055121403 9:72664799-72664821 CAGGTTCTTGTCCAGTGTCCAGG - Intronic
1055202507 9:73684163-73684185 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1055803656 9:80068791-80068813 TGGGTTCTTGTTTCATGACCAGG + Intergenic
1055890856 9:81122320-81122342 CAAGTTCTTATCTCATGTTCAGG + Intergenic
1056350549 9:85744477-85744499 CAGGTTCTTGTCTCAAGACCAGG + Intergenic
1056545028 9:87606268-87606290 CAGCATCTTGTCTCATCACTGGG + Intronic
1056570266 9:87808554-87808576 CAGGTACTTGTCTCATGACCAGG - Intergenic
1057174751 9:92988055-92988077 CGGGTTCTTGTCTCATTACCAGG + Intronic
1057342426 9:94214601-94214623 CAGGTTCTTGTCACACGACCAGG - Intergenic
1057468621 9:95338194-95338216 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
1057562087 9:96136371-96136393 CAGGATCTTGTCTGTTGCCCAGG - Intergenic
1057679786 9:97168623-97168645 TGGGTTCTTCTCTCATGACCAGG - Intergenic
1058047794 9:100375669-100375691 AGGTTTCTTGTCTCATGACCAGG + Intergenic
1058281891 9:103126817-103126839 CTGGTTCTTGTCACACCACCAGG + Intergenic
1058282450 9:103132200-103132222 TAGGTTCTTGTGACATGAACAGG + Intergenic
1059190942 9:112325510-112325532 CAGGTTCTTGTCTCACAACCAGG - Intronic
1059833101 9:118120404-118120426 TGGGTTATTGTCACATGACCAGG - Intergenic
1060191069 9:121593107-121593129 CAGGGTCTTGTCTGCTGCCCAGG + Intronic
1060231531 9:121828937-121828959 CAGGGTCTTGTCTGTTGCCCAGG - Intronic
1060486916 9:124053629-124053651 CAGGGTCTTGTCTCATGACCAGG - Intergenic
1061946294 9:133910018-133910040 CAGATTCTAGTCACATGGCCTGG - Intronic
1062666663 9:137676968-137676990 CCGGTTCTTGTCACACAACCAGG - Intronic
1062702645 9:137915792-137915814 CTTTTTCTTGTCTCATGACCTGG - Intronic
1203692620 Un_GL000214v1:59534-59556 TGGGTTCTTCTCTCGTGACCAGG - Intergenic
1203706434 Un_KI270742v1:53059-53081 TGTGTTCTTCTCTCATGACCAGG + Intergenic
1203556805 Un_KI270744v1:6426-6448 TGGGTTCTTCTCTCGTGACCAGG - Intergenic
1203643675 Un_KI270751v1:44657-44679 TGGGTTCTTCTCTCGTGACCAGG + Intergenic
1185722851 X:2395775-2395797 CAAGTTCTTGTCCCATGACCTGG + Intronic
1187842891 X:23506952-23506974 CGGGCTCTTGTCACATGACCAGG - Intergenic
1187981420 X:24761755-24761777 CTGGTTCTTGCCTCATAGCCAGG + Intronic
1188179288 X:27034365-27034387 CGGGTTCCTGTCTCATGACCAGG + Intergenic
1188212851 X:27444385-27444407 TGGGTTCTTGTCTCACAACCAGG + Intergenic
1188375271 X:29421166-29421188 CAGGTTCTTGTCACATGACCAGG + Intronic
1188725885 X:33580959-33580981 CAGGTTCTTTTCTGATGCCAGGG + Intergenic
1188859798 X:35243601-35243623 CAAGTTCTTGTCCTGTGACCAGG + Intergenic
1189649800 X:43177114-43177136 CAGGTTCTTGTCACAGGACCAGG - Intergenic
1189947767 X:46196475-46196497 CAGGTTCTTGTCTCACAACCAGG - Intergenic
1190548792 X:51557833-51557855 TGGGTTCTTTTCACATGACCAGG + Intergenic
1190576769 X:51847474-51847496 TGGGTTCTTGTCACAAGACCAGG + Intronic
1190620630 X:52284105-52284127 CAAGTTCTTGTCTTGTGTCCAGG + Intergenic
1191189446 X:57650943-57650965 CAGGTTCTTTTGTCACAACCAGG - Intergenic
1192950790 X:76014241-76014263 CAAATCCTTCTCTCATGACCTGG - Intergenic
1193140545 X:78022165-78022187 CAGATTCTTGTCACACGACCAGG - Intronic
1193268891 X:79506508-79506530 TGGGTTCTTATCACATGACCAGG - Intergenic
1193269877 X:79516258-79516280 TGGGTTCTTGTCACATGACCAGG - Intergenic
1193515467 X:82456493-82456515 CAGGTACTATTCTCATCACCTGG + Intergenic
1193699968 X:84748236-84748258 CGGGTTCTTGTCACACGACCAGG - Intergenic
1194059231 X:89177251-89177273 CGGGATCTTGTCTCATCACCAGG + Intergenic
1194088872 X:89562083-89562105 CAAGTTCTTGTGACACGACCAGG + Intergenic
1194160487 X:90444172-90444194 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1194163357 X:90483329-90483351 CAGGTTCTTGTCCAGTGTCCAGG + Intergenic
1194227608 X:91280267-91280289 CAGGTTCTTGTCTTATGACCAGG + Intergenic
1194476013 X:94360795-94360817 CAGGTTCTTGTCTCATGACTAGG + Intergenic
1194640981 X:96404150-96404172 CAGGTTCTTGTCACACGACCAGG + Intergenic
1194653082 X:96538636-96538658 CCGGTTCTTGTCACACGACCAGG - Intergenic
1194680264 X:96843557-96843579 TGGGTTCTTGTCACATGACCAGG + Intronic
1195352581 X:104009108-104009130 CAACTTCTTGTCTGATGGCCTGG + Intergenic
1195356514 X:104044454-104044476 CAACTTCTTGTCTGATGGCCTGG - Intergenic
1196691516 X:118563923-118563945 CCAGTTCTTGTCACATAACCAGG + Intronic
1196754635 X:119147428-119147450 CAGGTACTTGACACCTGACCAGG - Intronic
1196861654 X:120034275-120034297 AAGGATCTTGTCTAATGACATGG + Intergenic
1197035730 X:121870924-121870946 CAAGTTCTTGTCCCATATCCAGG - Intergenic
1197040281 X:121928774-121928796 CAGGTTCTTTCCTCATCATCTGG - Intergenic
1197064251 X:122220286-122220308 CGGGTTCCTGTCTCACAACCAGG - Intergenic
1197066706 X:122241940-122241962 TGGGTTCTTGTCTCATGGCCAGG + Intergenic
1197299458 X:124760264-124760286 CAGGTTCTTGTCACACGACCAGG - Intronic
1197300845 X:124778434-124778456 CAGATTCTTGTCACATGACCAGG - Intronic
1197509827 X:127356725-127356747 TGGGTTCTTGTCTCATGACCAGG - Intergenic
1197744802 X:129924901-129924923 CAGGTTCCTCTCTCTGGACCTGG - Exonic
1197828627 X:130617200-130617222 CAGGTTTTTCTCTCCTGAACTGG + Intergenic
1197971308 X:132118331-132118353 CAGGTTCTTGTCACACGACCAGG + Intronic
1198043590 X:132878108-132878130 CAGGTTCTCGTCTCATGACTAGG + Intronic
1198139317 X:133786826-133786848 TGGGTTCTTGTCACATGACCAGG - Intronic
1198363035 X:135914695-135914717 CAAGTTCTTGTCACACGACCAGG + Intergenic
1199614854 X:149648230-149648252 CAAGTTCTTGTCCTGTGACCAGG - Intergenic
1199829818 X:151538389-151538411 CAAGTTCTTGTCACATGACCAGG + Intergenic
1200258342 X:154597798-154597820 TGGGTTCTTGTCACATGACCAGG - Intergenic
1200441548 Y:3218135-3218157 CAAGTTCTTGTGACACGACCAGG + Intergenic
1200506777 Y:4021112-4021134 CAGGTTCTTGTCTCACGACCAGG + Intergenic
1200509626 Y:4061054-4061076 CAGGTTCTTGTCCAGTGTCCAGG + Intergenic
1200852117 Y:7894002-7894024 CAGGATCTTGTCACATGATCAGG - Intergenic
1200898687 Y:8404579-8404601 TGGGTTCTTGTCACATGACTAGG - Intergenic
1201221297 Y:11773403-11773425 TGGGTTCTTGTCTCATGACCAGG + Intergenic
1201319138 Y:12678007-12678029 TGGTTTCTTGTCTCATGACCAGG + Intergenic
1201961894 Y:19690096-19690118 CGGGTGCTTGTCTCATGAGATGG + Intergenic
1202258949 Y:22949520-22949542 TGGGTTCTTGTCACATGACTAGG + Intergenic
1202411937 Y:24583277-24583299 TGGGTTCTTGTCACATGACTAGG + Intergenic
1202458845 Y:25086795-25086817 TGGGTTCTTGTCACATGACTAGG - Intergenic