ID: 1030498159

View in Genome Browser
Species Human (GRCh38)
Location 7:110326180-110326202
Sequence CTGCATATTAAGATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030498157_1030498159 0 Left 1030498157 7:110326157-110326179 CCAAAGACATCGGAACAGAAATT No data
Right 1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030498159 Original CRISPR CTGCATATTAAGATGGAGCA TGG Intergenic
No off target data available for this crispr