ID: 1030499148

View in Genome Browser
Species Human (GRCh38)
Location 7:110337542-110337564
Sequence CAGGTAAAGCTTAATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030499148_1030499151 16 Left 1030499148 7:110337542-110337564 CCTACCTCATTAAGCTTTACCTG No data
Right 1030499151 7:110337581-110337603 CTACTCTCTTCTGCCCATGTTGG No data
1030499148_1030499152 17 Left 1030499148 7:110337542-110337564 CCTACCTCATTAAGCTTTACCTG No data
Right 1030499152 7:110337582-110337604 TACTCTCTTCTGCCCATGTTGGG No data
1030499148_1030499153 18 Left 1030499148 7:110337542-110337564 CCTACCTCATTAAGCTTTACCTG No data
Right 1030499153 7:110337583-110337605 ACTCTCTTCTGCCCATGTTGGGG No data
1030499148_1030499154 21 Left 1030499148 7:110337542-110337564 CCTACCTCATTAAGCTTTACCTG No data
Right 1030499154 7:110337586-110337608 CTCTTCTGCCCATGTTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030499148 Original CRISPR CAGGTAAAGCTTAATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr