ID: 1030499335

View in Genome Browser
Species Human (GRCh38)
Location 7:110339898-110339920
Sequence CATCTTGGACAGCTTTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030499335_1030499344 24 Left 1030499335 7:110339898-110339920 CCTCCCGAAAGCTGTCCAAGATG No data
Right 1030499344 7:110339945-110339967 CCCCTTTGCACTACAGTTGAGGG No data
1030499335_1030499342 23 Left 1030499335 7:110339898-110339920 CCTCCCGAAAGCTGTCCAAGATG No data
Right 1030499342 7:110339944-110339966 TCCCCTTTGCACTACAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030499335 Original CRISPR CATCTTGGACAGCTTTCGGG AGG (reversed) Intergenic
No off target data available for this crispr