ID: 1030502733

View in Genome Browser
Species Human (GRCh38)
Location 7:110380423-110380445
Sequence CAGCCAGTTGGCCCGGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030502733_1030502738 -5 Left 1030502733 7:110380423-110380445 CCCCACACCGGGCCAACTGGCTG No data
Right 1030502738 7:110380441-110380463 GGCTGATGATTTAAGTGATCTGG No data
1030502733_1030502739 -4 Left 1030502733 7:110380423-110380445 CCCCACACCGGGCCAACTGGCTG No data
Right 1030502739 7:110380442-110380464 GCTGATGATTTAAGTGATCTGGG No data
1030502733_1030502740 3 Left 1030502733 7:110380423-110380445 CCCCACACCGGGCCAACTGGCTG No data
Right 1030502740 7:110380449-110380471 ATTTAAGTGATCTGGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030502733 Original CRISPR CAGCCAGTTGGCCCGGTGTG GGG (reversed) Intergenic
No off target data available for this crispr