ID: 1030504070

View in Genome Browser
Species Human (GRCh38)
Location 7:110397796-110397818
Sequence CAAAATCATGAGATTGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030504066_1030504070 21 Left 1030504066 7:110397752-110397774 CCTCTTTAGTGGCACTATGCCTA No data
Right 1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG No data
1030504067_1030504070 2 Left 1030504067 7:110397771-110397793 CCTAGAAACTAGTCTTTGTTTCA No data
Right 1030504070 7:110397796-110397818 CAAAATCATGAGATTGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030504070 Original CRISPR CAAAATCATGAGATTGAGTC AGG Intergenic
No off target data available for this crispr