ID: 1030504203

View in Genome Browser
Species Human (GRCh38)
Location 7:110399120-110399142
Sequence CTGAATATTAAGATCAGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030504197_1030504203 30 Left 1030504197 7:110399067-110399089 CCGTAGGTGGTTGAAATCATGCC No data
Right 1030504203 7:110399120-110399142 CTGAATATTAAGATCAGCAGAGG No data
1030504200_1030504203 9 Left 1030504200 7:110399088-110399110 CCAAATGGAATAGTCTTCAGGAG No data
Right 1030504203 7:110399120-110399142 CTGAATATTAAGATCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030504203 Original CRISPR CTGAATATTAAGATCAGCAG AGG Intergenic
No off target data available for this crispr