ID: 1030506444

View in Genome Browser
Species Human (GRCh38)
Location 7:110430074-110430096
Sequence CAGTTCCAAGGTAATTCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030506439_1030506444 1 Left 1030506439 7:110430050-110430072 CCTAAATAGCATCCCATTCAACA No data
Right 1030506444 7:110430074-110430096 CAGTTCCAAGGTAATTCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030506444 Original CRISPR CAGTTCCAAGGTAATTCAAT GGG Intergenic
No off target data available for this crispr