ID: 1030515893

View in Genome Browser
Species Human (GRCh38)
Location 7:110537294-110537316
Sequence CTGTGTTAGTAGGTTTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030515885_1030515893 22 Left 1030515885 7:110537249-110537271 CCTTTTTCTCCAAACCCCTTGTT No data
Right 1030515893 7:110537294-110537316 CTGTGTTAGTAGGTTTATCTTGG No data
1030515889_1030515893 8 Left 1030515889 7:110537263-110537285 CCCCTTGTTTCTCTGGTTGGTTC No data
Right 1030515893 7:110537294-110537316 CTGTGTTAGTAGGTTTATCTTGG No data
1030515891_1030515893 6 Left 1030515891 7:110537265-110537287 CCTTGTTTCTCTGGTTGGTTCTC No data
Right 1030515893 7:110537294-110537316 CTGTGTTAGTAGGTTTATCTTGG No data
1030515887_1030515893 13 Left 1030515887 7:110537258-110537280 CCAAACCCCTTGTTTCTCTGGTT No data
Right 1030515893 7:110537294-110537316 CTGTGTTAGTAGGTTTATCTTGG No data
1030515890_1030515893 7 Left 1030515890 7:110537264-110537286 CCCTTGTTTCTCTGGTTGGTTCT No data
Right 1030515893 7:110537294-110537316 CTGTGTTAGTAGGTTTATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030515893 Original CRISPR CTGTGTTAGTAGGTTTATCT TGG Intergenic
No off target data available for this crispr