ID: 1030516258

View in Genome Browser
Species Human (GRCh38)
Location 7:110542242-110542264
Sequence TTTATCTAAAAGACCTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030516258_1030516259 29 Left 1030516258 7:110542242-110542264 CCTACTTAGGTCTTTTAGATAAA No data
Right 1030516259 7:110542294-110542316 TCCACTTTTTTTCCTCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030516258 Original CRISPR TTTATCTAAAAGACCTAAGT AGG (reversed) Intergenic
No off target data available for this crispr