ID: 1030519211

View in Genome Browser
Species Human (GRCh38)
Location 7:110576525-110576547
Sequence AGGTATGCAAAGATTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030519211_1030519217 24 Left 1030519211 7:110576525-110576547 CCCTCCTCAATCTTTGCATACCT No data
Right 1030519217 7:110576572-110576594 ATATAAAAGACAATCACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030519211 Original CRISPR AGGTATGCAAAGATTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr