ID: 1030521309

View in Genome Browser
Species Human (GRCh38)
Location 7:110601537-110601559
Sequence CACTGCTTCTAGAAGTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030521306_1030521309 5 Left 1030521306 7:110601509-110601531 CCAATACTGGAAGGCCAGTTCTA No data
Right 1030521309 7:110601537-110601559 CACTGCTTCTAGAAGTCTTTTGG No data
1030521303_1030521309 22 Left 1030521303 7:110601492-110601514 CCATAAGTATAGTGTATCCAATA No data
Right 1030521309 7:110601537-110601559 CACTGCTTCTAGAAGTCTTTTGG No data
1030521308_1030521309 -9 Left 1030521308 7:110601523-110601545 CCAGTTCTAGGAGACACTGCTTC No data
Right 1030521309 7:110601537-110601559 CACTGCTTCTAGAAGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030521309 Original CRISPR CACTGCTTCTAGAAGTCTTT TGG Intergenic
No off target data available for this crispr