ID: 1030535786

View in Genome Browser
Species Human (GRCh38)
Location 7:110765167-110765189
Sequence TCTACTATGTAAAAGCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030535786 Original CRISPR TCTACTATGTAAAAGCAGGT AGG Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907643106 1:56212438-56212460 ACTACAATATAAAAGCAAGTAGG + Intergenic
909507395 1:76409031-76409053 TCTATTGTGTAAAAGAAGGTAGG + Intronic
915657335 1:157372155-157372177 TCTACTGTGTAGACACAGGTGGG - Intergenic
918937734 1:190945198-190945220 TCTTCTATATAAATACAGGTAGG - Intergenic
1063804105 10:9618155-9618177 TCTATTTTTTAAAAGCAGCTTGG - Intergenic
1064666240 10:17654746-17654768 ACCAATATGTAAAAGCAGTTTGG - Intronic
1066316715 10:34254727-34254749 TCTGCTATGTGATACCAGGTGGG + Intronic
1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG + Intronic
1073801921 10:107050812-107050834 TCTACTATGTCAAAGAAGAGTGG + Intronic
1074037625 10:109756909-109756931 TCTACTTTACATAAGCAGGTTGG + Intergenic
1075536748 10:123277943-123277965 TCTACTCTGAAAATGCAGATTGG - Intergenic
1078047583 11:7930732-7930754 CCAACTATGTAAAAGTAGATTGG + Intergenic
1079047894 11:17124570-17124592 TAAACTCTGTAAAGGCAGGTTGG - Intronic
1085003183 11:73060040-73060062 TGTTCTTTTTAAAAGCAGGTAGG + Intronic
1088518463 11:110665772-110665794 GCCACTAGGAAAAAGCAGGTAGG + Intronic
1091453509 12:588062-588084 TCCACTATGTAAACACAGATAGG + Intronic
1095761919 12:45849208-45849230 TTTAACATGTAAAAGTAGGTAGG - Intronic
1096023465 12:48341324-48341346 TCTTGTATGTAAGAGCAGTTCGG - Exonic
1097765075 12:63516942-63516964 TATACTATTTAAAAACAAGTAGG + Intergenic
1098983313 12:76983834-76983856 TCCACTATGGAAAAGAAAGTTGG + Intergenic
1100795634 12:98179056-98179078 TGTACTAATTAAAAGCAGTTGGG - Intergenic
1103972467 12:124680694-124680716 TCTCTTTTTTAAAAGCAGGTAGG + Intergenic
1107628954 13:42323469-42323491 TCTACTTTGCAAAAACAGGTTGG - Intergenic
1107823439 13:44306494-44306516 TGTAAGATGTAAAAGCAGGGAGG - Intergenic
1110341612 13:74398226-74398248 TCTATTATGTAAACTCAGGAAGG + Intergenic
1115225468 14:31097338-31097360 TCTACTATATATATGCATGTAGG + Intergenic
1115788535 14:36853905-36853927 CCTTCTATATAAAAGTAGGTAGG + Intronic
1118782889 14:69021633-69021655 TCTACTCTGTAGGATCAGGTTGG - Intergenic
1121588506 14:95081039-95081061 GCTACCATGTAAAAGCAGTAAGG + Intergenic
1121755976 14:96402441-96402463 TCCAGCTTGTAAAAGCAGGTGGG - Intronic
1124230540 15:27942075-27942097 TCTGCTCTGGAAAAGCAGTTAGG + Intronic
1124851343 15:33341602-33341624 TCTACCATCTAGAAGCAGGAGGG + Intronic
1126567981 15:50119704-50119726 TCATCTCTGCAAAAGCAGGTGGG - Intronic
1126680874 15:51201095-51201117 TCTCCTATATAATAGGAGGTAGG + Intergenic
1129623065 15:77167228-77167250 TGAACTATGAAAAAGCAGGGAGG + Intronic
1137631551 16:49949625-49949647 ACAACTAGGTAAAAGCTGGTAGG + Intergenic
1137960008 16:52873323-52873345 TCTACTATGTTAAAGGGGTTTGG + Intergenic
1143436208 17:6928650-6928672 TATACTATCTAAAAGCAGAGAGG + Intronic
1145855977 17:28157737-28157759 ACTACTATGTAACCGTAGGTAGG + Intronic
1146639355 17:34528132-34528154 TCTGCTGTGTGAAAGCAGGCAGG - Intergenic
1150750756 17:67860170-67860192 TTTTCTATGTAAAATCAAGTAGG + Intronic
1155555441 18:27013895-27013917 TCTTTTATGTAAAAGTAGGTTGG + Intronic
1155835571 18:30579164-30579186 TCTAATATGTAAAACCTTGTTGG - Intergenic
1157887865 18:51385660-51385682 TCTACTATTTAGAAGCAGGTGGG + Intergenic
1158085710 18:53649585-53649607 TCTACTTTGAAAAAGCAGGTAGG + Intergenic
1158285381 18:55875243-55875265 GCTTCTATGTAAAAGCACTTGGG - Intergenic
1158544405 18:58383702-58383724 TCTATTATGGAAAAGAAGTTGGG - Intronic
1167450558 19:49565932-49565954 TCCACTATGACAAAGCAGTTTGG + Intronic
925668987 2:6291506-6291528 TCCATGATGTAAAAGCAGGAAGG + Intergenic
927658081 2:24968678-24968700 TCTACTATTTGAGAGTAGGTTGG - Intronic
927840644 2:26440812-26440834 TCATTTATGTAAAAGCAGATGGG - Intronic
931002846 2:57808228-57808250 CCTTCTAGGTAAAAGCAGTTTGG - Intergenic
931944887 2:67295110-67295132 TCTACTATGATAAAGCAGAGTGG - Intergenic
932802572 2:74754643-74754665 TCTTCAATGTAAAAGGACGTTGG - Intergenic
932887268 2:75559678-75559700 TGTACTATGAGAAAGGAGGTGGG + Intronic
932981178 2:76669213-76669235 TCTAATGTGTAAAAGCATTTGGG + Intergenic
935125535 2:100219351-100219373 TCTACTGTTTAATAGCAGGGTGG + Intergenic
938635205 2:133217793-133217815 TGTACTATGTAAATGCAAGATGG - Intronic
940648930 2:156421259-156421281 TCAACTCTGTAAAAACAGTTTGG - Intergenic
940716703 2:157234061-157234083 TCAATTATGTCAAAGAAGGTTGG + Intergenic
941594066 2:167453783-167453805 TCAAATATGTAAAAGGAGGAAGG + Intergenic
942135080 2:172917291-172917313 TGTACGATGTAAAAGGAAGTAGG + Intronic
944353743 2:198760393-198760415 TCTAGTAGTTAAAAGCAGGCAGG - Intergenic
945619679 2:212119348-212119370 TTTAAAATGTAAAAGCTGGTGGG + Intronic
946678775 2:222190963-222190985 TCAACTGTGTAAGAGCAGATGGG - Intergenic
1170422972 20:16210761-16210783 TTTACTATTTAAAAGGAGGCTGG + Intergenic
1177162158 21:17559483-17559505 TCTACAATATACAAGCAGGCTGG - Intronic
1178121806 21:29476858-29476880 TCTATCATGTTAAAGCAGTTTGG + Intronic
1178562908 21:33655897-33655919 TCCACTATCTAAATGCAGTTGGG + Intronic
1181646465 22:24233869-24233891 TCTACAATGTGACAACAGGTGGG - Exonic
1185388137 22:50545889-50545911 TCTACCAGGCAGAAGCAGGTTGG + Intergenic
949370799 3:3332792-3332814 GCTGCTATGTAGAGGCAGGTAGG + Intergenic
951367164 3:21797591-21797613 TCACCTATGTAAAAACAGCTTGG - Intronic
952734531 3:36675665-36675687 TCAAGTAAGTAAAAGCAGGAAGG - Intergenic
956827601 3:73013042-73013064 TCTACTATGAACAAGCAGGCAGG - Intronic
959321546 3:104882108-104882130 TCCACCAAGTAAAAGCTGGTGGG + Intergenic
959361544 3:105400050-105400072 TCAATTATTTAAAAACAGGTAGG - Intronic
960979252 3:123206369-123206391 TTTAGTATTTAAAAGCAGATTGG - Intronic
961540258 3:127594596-127594618 TCTAATATGTAAATTCAGGTGGG + Intronic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
969961869 4:10952629-10952651 GCCACTATGCAGAAGCAGGTTGG + Intergenic
970810631 4:20089262-20089284 CCTATTACGTAAAAGCAGGTGGG + Intergenic
971245184 4:24920935-24920957 TCTAGCATGGAAAAGAAGGTGGG + Intronic
973624070 4:52753450-52753472 TGTACTAGGTAAAAGTAGCTTGG - Intergenic
981124147 4:141086484-141086506 TCTACTAATTAAAAGCAAGCTGG - Intronic
981223547 4:142265013-142265035 TCTTCTGTGTATAAGCAGGAAGG - Intronic
981332454 4:143527774-143527796 TCTAGTATATAAAAAGAGGTGGG - Intronic
982162248 4:152581827-152581849 TCTTCTATGAAGAAGCAGTTAGG + Intergenic
983637513 4:169913005-169913027 TCTACGATGTAAAGCCAGGATGG + Intergenic
985190562 4:187367894-187367916 TCTGGTTTGTAAAAGCAGCTTGG + Intergenic
988704734 5:33713940-33713962 TCTTATCTGTAAAAGAAGGTTGG - Intronic
992577559 5:78133225-78133247 TATACTCTGACAAAGCAGGTGGG - Intronic
993884596 5:93400942-93400964 ATTACTAGTTAAAAGCAGGTAGG + Intergenic
994003909 5:94815333-94815355 TCAAGCATGGAAAAGCAGGTGGG + Intronic
995694064 5:114860024-114860046 TCTAGTATCTAAAATGAGGTGGG + Intergenic
996490445 5:124088449-124088471 TTTACTTTGTAAAAGTAGGAGGG - Intergenic
996664063 5:126037215-126037237 TCTACTATGGGAATGCTGGTAGG - Intergenic
999090335 5:148930582-148930604 TATCCTATGAAAAAACAGGTGGG + Intronic
1000944361 5:167402130-167402152 TCTTCTAAGTAAAAGCTGGGTGG + Intronic
1001268415 5:170292166-170292188 TCCAGTATGTAAAAGCAGTTCGG + Intronic
1003908763 6:10725020-10725042 TTGGCTATGTAAAAGCAGGTAGG + Exonic
1003911762 6:10749681-10749703 TTGGCTATGTAAAAACAGGTAGG + Exonic
1004464807 6:15874662-15874684 ACTACTATGTGAAAGCAACTGGG - Intergenic
1006551410 6:34826320-34826342 TGTAACATGTAAAAGCATGTAGG - Intronic
1007827842 6:44614731-44614753 TCTACTAGTTAGAAGCAAGTCGG + Intergenic
1008086161 6:47246720-47246742 CTTAATATGAAAAAGCAGGTGGG + Intronic
1010918385 6:81649496-81649518 TCTATTGTGTAAATGCAGCTGGG - Intronic
1011369983 6:86626235-86626257 GCTCCAATGTAAAAGCAGGTTGG + Intergenic
1012179262 6:96130618-96130640 AATAATATGTAAAAACAGGTTGG - Intronic
1014159667 6:118153572-118153594 TTTTCTGTGTAAAAGCATGTGGG + Intronic
1016249968 6:142028969-142028991 GCCACTATGTTAAAGCAGTTTGG - Intergenic
1018833027 6:167460547-167460569 TCTCCTATTTAAAAGCAATTGGG + Intergenic
1021895092 7:25226062-25226084 TCTACTATAAAAGAACAGGTAGG + Intronic
1022049702 7:26653938-26653960 CCTATTTTCTAAAAGCAGGTTGG - Intergenic
1022407806 7:30108354-30108376 TATACTTTGTAAAATGAGGTGGG + Intronic
1023015270 7:35962678-35962700 TTTCCTATTTAAAAGCAGGCAGG + Intergenic
1023620330 7:42065315-42065337 TCTACTCTTAACAAGCAGGTGGG - Intronic
1023683124 7:42708760-42708782 TATACTATGTCACAGCAGATTGG - Intergenic
1023920514 7:44625971-44625993 TCTAAAATTTAAAAGAAGGTGGG + Intronic
1024065675 7:45732014-45732036 TTTCCTATTTAAAAGCAGGCAGG - Intergenic
1024910904 7:54445652-54445674 TGTACTATGCAGAAGCAGGAAGG - Intergenic
1028359594 7:89951893-89951915 ACTTCTATGTAAAATGAGGTAGG - Intergenic
1028963940 7:96780453-96780475 CCAACTATGTAAAAGCATATAGG + Intergenic
1030535786 7:110765167-110765189 TCTACTATGTAAAAGCAGGTAGG + Intronic
1032203869 7:129844830-129844852 TTTACTATTTAAAAACAGGCTGG + Intronic
1034957031 7:155341233-155341255 TTCACTGTGTCAAAGCAGGTGGG - Intergenic
1035969362 8:4229735-4229757 TATGCTATGTAGAAGCAGGACGG - Intronic
1038259775 8:25982564-25982586 ACTTCTATCTAAAAGGAGGTTGG + Intronic
1039266602 8:35831298-35831320 TTTACTATGTGACAGCTGGTGGG - Intergenic
1039672879 8:39623403-39623425 ACTACTATGGAAAAGCAGTATGG - Intronic
1043413366 8:80023177-80023199 TCTATAATGTAAAAACAGGTTGG + Intronic
1050624532 9:7488763-7488785 TCTCCTATGTAAAAGGTGCTAGG - Intergenic
1050747668 9:8895761-8895783 TTTACTGTGTAAAGACAGGTAGG + Intronic
1055750880 9:79503641-79503663 TCTCTTGTGTAAAAGCAGGCTGG + Intergenic
1056310421 9:85335253-85335275 TCCCCTATGGAAAAGCAGGCAGG + Intergenic
1058534164 9:105938198-105938220 TCTAGTATGTAAAAGAATTTAGG - Intergenic
1058980417 9:110164255-110164277 TCTTCAATTTAAAAGCAGGTTGG + Intronic
1059614524 9:115934536-115934558 TGTACTATGTAATATCAGGCAGG - Intergenic
1187202044 X:17144465-17144487 TCTCCTACGTAAAATCAAGTTGG + Intronic
1188620469 X:32215780-32215802 TCTTCTATATTAAAGCAGATTGG + Intronic
1191122623 X:56921941-56921963 TCTACTATGGAAATGCAGAGGGG + Intergenic
1193335522 X:80284362-80284384 TCCACTTTGGAAAAGCAGTTTGG - Intergenic
1194505560 X:94729799-94729821 TACACAATGTAAAAGCAGCTGGG - Intergenic
1195974118 X:110507201-110507223 TCTACTCTGTGAAAGAAGCTAGG + Intergenic
1197405765 X:126047100-126047122 GCTACTATGAAAAAGAAAGTGGG + Intergenic
1197704443 X:129623592-129623614 TCTACTATTTAAAATATGGTGGG + Intergenic
1199353223 X:146829699-146829721 CCTACTATCTAAAAGTAAGTAGG + Intergenic
1199446367 X:147927076-147927098 TCTACTAGGTGTAAGCAGCTGGG + Intronic
1199920202 X:152393514-152393536 CCTACAATATAAAAGCAGGTGGG + Intronic