ID: 1030541712

View in Genome Browser
Species Human (GRCh38)
Location 7:110838448-110838470
Sequence ATGGCAGTACTGAAAGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030541705_1030541712 10 Left 1030541705 7:110838415-110838437 CCCGAATTTCATGTGTTAGAAAC 0: 1
1: 9
2: 126
3: 444
4: 959
Right 1030541712 7:110838448-110838470 ATGGCAGTACTGAAAGATGGGGG 0: 1
1: 0
2: 1
3: 18
4: 205
1030541704_1030541712 11 Left 1030541704 7:110838414-110838436 CCCCGAATTTCATGTGTTAGAAA 0: 1
1: 8
2: 107
3: 450
4: 866
Right 1030541712 7:110838448-110838470 ATGGCAGTACTGAAAGATGGGGG 0: 1
1: 0
2: 1
3: 18
4: 205
1030541706_1030541712 9 Left 1030541706 7:110838416-110838438 CCGAATTTCATGTGTTAGAAACT 0: 8
1: 79
2: 342
3: 670
4: 1215
Right 1030541712 7:110838448-110838470 ATGGCAGTACTGAAAGATGGGGG 0: 1
1: 0
2: 1
3: 18
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030541712 Original CRISPR ATGGCAGTACTGAAAGATGG GGG Intronic
903098460 1:21003937-21003959 ATGGCAGCACAAAAAGATGAAGG + Intronic
903203118 1:21759581-21759603 AATGATGTACTGAAAGATGGTGG + Intronic
906671514 1:47658519-47658541 GAGTCAGTGCTGAAAGATGGAGG - Intergenic
908066713 1:60413910-60413932 ATGGCAGTGCTGTTTGATGGAGG + Intergenic
908309154 1:62858412-62858434 ATGGGAGAACTGAAATATTGAGG - Intronic
908663719 1:66466015-66466037 ATAGCAGTACTGAAAAAAAGAGG + Intergenic
908998535 1:70189188-70189210 TTGGTGCTACTGAAAGATGGTGG - Exonic
911127569 1:94354497-94354519 ATGGCAGAATGGAGAGATGGCGG + Intergenic
912569664 1:110612166-110612188 AAGGCAGTACAGCAAGGTGGTGG + Intronic
915773907 1:158461588-158461610 CTGGGAGTCCTGATAGATGGAGG + Intergenic
916610746 1:166389207-166389229 ATTGCAGTATGGATAGATGGCGG + Intergenic
916979157 1:170114976-170114998 ATGGCAGTAGAGAAAAATGCAGG + Intergenic
917736094 1:177921585-177921607 CTGGCAGTGCTGAGAGAAGGGGG + Intergenic
918398198 1:184137361-184137383 ATGACAGTGCTCAAAAATGGTGG - Intergenic
920877807 1:209853663-209853685 ATGGCAGTAGAAAAAGATGTAGG - Exonic
924508631 1:244710222-244710244 AGGGAAGTGCTCAAAGATGGGGG - Intergenic
924758704 1:246964927-246964949 GTGGCAGTACTGCAAGATGGGGG + Intronic
1064867421 10:19896641-19896663 ATGGCAGTTCTGCACAATGGTGG + Intronic
1064991017 10:21256967-21256989 ATGGCAGTGGGGAGAGATGGTGG - Intergenic
1066318649 10:34277062-34277084 ATGGCAGTGCAGTAAGTTGGGGG - Intronic
1066649935 10:37644777-37644799 GTGGCAGTATTGAGAGGTGGGGG + Intergenic
1067032829 10:42890316-42890338 GTGGCAGTATTGAGAGGTGGGGG + Intergenic
1069588215 10:69623791-69623813 ATGGCAACACTGAAAGACAGAGG + Intergenic
1070004595 10:72411157-72411179 ATGAGAGTAGTCAAAGATGGTGG + Intronic
1072159068 10:92749550-92749572 GTGGCAGTATTGAAAGACGAGGG - Intergenic
1072923889 10:99599202-99599224 ATGGCATTACAAAAACATGGAGG + Intergenic
1075105502 10:119537614-119537636 ATGCCAGAAATGAAAGGTGGGGG + Intronic
1076513269 10:131027276-131027298 AGTGCAGTCCTGAAAGGTGGAGG - Intergenic
1076547211 10:131253383-131253405 ATTCCATTACTGAAAGCTGGGGG - Intronic
1078221093 11:9352346-9352368 AAAGCAAAACTGAAAGATGGAGG + Intergenic
1084658798 11:70535294-70535316 ATGGATGGACTGAATGATGGAGG - Intronic
1085928778 11:81055699-81055721 ATGGCATGACCCAAAGATGGAGG - Intergenic
1086834759 11:91607086-91607108 ATGGAAGAATTGAAAGATGAGGG - Intergenic
1087204024 11:95375129-95375151 AGGGCAGAACTCCAAGATGGAGG + Intergenic
1088931213 11:114352329-114352351 ATGGAAGCATTGAAAGATGTAGG + Intergenic
1091968285 12:4764010-4764032 ATGGCAGTAATACATGATGGGGG - Exonic
1092445170 12:8549066-8549088 ATGGCAGAACTACAAGGTGGAGG - Intergenic
1094514715 12:31119927-31119949 ATGGCAGTCCTAAGAGACGGGGG - Intergenic
1095201987 12:39395442-39395464 ATGGCGGTATGGAAACATGGCGG - Intronic
1095437018 12:42200903-42200925 ATGGGAATACTGAAATATAGAGG - Intronic
1096409419 12:51366278-51366300 ATTGCAGCTCTGGAAGATGGTGG - Intronic
1097066340 12:56323350-56323372 ATGGCAGTAAAGAAACACGGTGG - Exonic
1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG + Intronic
1099433489 12:82617231-82617253 AAAGCAAAACTGAAAGATGGAGG + Intergenic
1101809803 12:108097915-108097937 ATAGCAGTATTGAAAGATGAGGG + Intergenic
1102240684 12:111322717-111322739 ATGGCTGCACTGGAACATGGCGG + Intronic
1103000835 12:117384311-117384333 ATGTCAGCACTGATGGATGGAGG - Intronic
1103758233 12:123227951-123227973 AGGGCTGTTCTGAAAGTTGGGGG - Intronic
1104378120 12:128283255-128283277 AGGGCAGTGCTTAAAGAAGGAGG - Intronic
1105894838 13:24709130-24709152 CTGGCAGTTCTGAAGGATGCTGG - Intronic
1109570180 13:64178173-64178195 TTGACAATATTGAAAGATGGAGG + Intergenic
1111295356 13:86269908-86269930 ATGGCAGGGTTTAAAGATGGTGG + Intergenic
1111356305 13:87107815-87107837 ATGGCAGGACAGAAAAATGGTGG + Intergenic
1111604668 13:90521481-90521503 TTGGCATCCCTGAAAGATGGGGG + Intergenic
1113251325 13:108456130-108456152 ATGGCAGTAATTTAAGATGTGGG - Intergenic
1114847903 14:26346257-26346279 AGGGCAGTACAGAAACAAGGAGG - Intergenic
1119708315 14:76801576-76801598 ATGACAGTAGTGAAAGATAAAGG - Intronic
1120209209 14:81618203-81618225 AAGGCAGGAATGAAAGATGATGG - Intergenic
1120324468 14:83007487-83007509 GTGGCAGTACTGTAAGGTGGGGG - Intergenic
1122036984 14:98956182-98956204 AGGGAAGGACAGAAAGATGGTGG + Intergenic
1124345832 15:28920803-28920825 ATGGCAGCACTGAGATATGGGGG - Intronic
1124405043 15:29384724-29384746 AAGGGAGTGCTGGAAGATGGGGG - Intronic
1124818150 15:33017681-33017703 ATGTCAGTATCAAAAGATGGGGG + Intronic
1127292062 15:57579868-57579890 ATGGCAGGACTGGTAGAGGGAGG - Intergenic
1127538553 15:59914454-59914476 AGGGCTGTACTTGAAGATGGAGG - Intergenic
1127965628 15:63920830-63920852 ATGTGAGGACTGAAAGCTGGAGG - Intronic
1128601102 15:68996157-68996179 AAGGCAGTACTGCAAGGTAGAGG - Intronic
1130882853 15:88070066-88070088 ATGGTAGCACTGAAGGATGCTGG - Intronic
1131193166 15:90333465-90333487 AGGGCATTTCTGAGAGATGGAGG + Intergenic
1133403855 16:5507890-5507912 AGGGCAGAACTCTAAGATGGAGG - Intergenic
1133521047 16:6557514-6557536 ATGGAATTACTAAAAGTTGGCGG + Intronic
1134354762 16:13471244-13471266 ACAGCAGTCCTGAAATATGGAGG + Intergenic
1135843364 16:25896172-25896194 ATGAAAGTACTGAAGGATGCTGG + Intronic
1138929866 16:61639836-61639858 ATGGCCATATTGAAAGATGAAGG - Intergenic
1140430531 16:74899046-74899068 TTGGCACTACTGAAACATGAAGG + Intronic
1140636222 16:76917745-76917767 ATGGCAGGAGCGAAAAATGGAGG + Intergenic
1143138025 17:4722986-4723008 TTGGCAGTACTTAAAGCTTGTGG - Intergenic
1144935071 17:18891188-18891210 CTGGCAGTATTGAAGGATGGAGG + Intronic
1145722715 17:27088619-27088641 GTGGCAGAAAAGAAAGATGGTGG - Intergenic
1146020347 17:29272755-29272777 ATGTCAGTACTGAAAAATTTTGG + Intronic
1149018070 17:51931964-51931986 ATGGAAGTACTGAAAGGGGCAGG - Intronic
1149552635 17:57551615-57551637 ATGGCAGTGCAGGAAGAGGGGGG - Intronic
1151143091 17:72014229-72014251 ATGGCAGGAGTGACAGCTGGTGG - Intergenic
1153553412 18:6285247-6285269 GTGGCAGCACTGAAGGATGGTGG + Intronic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1155656977 18:28203994-28204016 ATGGCCTTAAAGAAAGATGGTGG - Intergenic
1155840553 18:30637281-30637303 ATTGCAGTACTGCAAGATGATGG + Intergenic
1156163055 18:34383463-34383485 ATTGAAGTACAGATAGATGGAGG - Intergenic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
927085320 2:19669432-19669454 ATGGCAACACTGAAGGATGATGG + Intergenic
927277201 2:21272235-21272257 TGTGCAGTACAGAAAGATGGAGG - Intergenic
929471636 2:42199715-42199737 ATGGCAGTAGTGAAAAAGGTTGG + Intronic
932290949 2:70578964-70578986 ATGGCAGGATTGACTGATGGTGG + Intergenic
932695464 2:73952575-73952597 ATGGCTGGACTGAAAGAAGCAGG + Intronic
933316739 2:80724512-80724534 TTAGAAGTCCTGAAAGATGGTGG + Intergenic
934511337 2:94946759-94946781 GTGGCAGAAAAGAAAGATGGTGG - Intergenic
935774818 2:106463974-106463996 ATAACAGTACTGAAAGAATGAGG + Intronic
935900592 2:107788248-107788270 ATAGAAGGACTGAAAAATGGGGG + Intergenic
935905251 2:107831938-107831960 ATAACAGTACTGAAAGAATGAGG - Intronic
935991617 2:108723642-108723664 ATAACAGTACTGAAAGAATGAGG - Intronic
936844069 2:116808833-116808855 ATAACAGTTCTGAAACATGGAGG + Intergenic
938301719 2:130219130-130219152 TTGGCAGTACTTGAAGACGGTGG + Intergenic
938454981 2:131455321-131455343 TTGGCAGTACTTGAAGACGGTGG - Intergenic
940409907 2:153349546-153349568 ATGACAGCTCTTAAAGATGGTGG + Intergenic
940521135 2:154749782-154749804 ATGGCTGTCTTCAAAGATGGAGG - Intronic
940964246 2:159820143-159820165 ATGTTATTACTGAAGGATGGTGG - Intronic
941376587 2:164739009-164739031 ATGGTTGGACTGAAAGAAGGAGG - Intronic
941568219 2:167135812-167135834 AAGGCAGAAATGAAAGAGGGAGG - Intronic
942148610 2:173051805-173051827 ATGGCATTTTTGAAAGATTGTGG - Exonic
943675390 2:190711669-190711691 ATGGCAGTGCAGAGAGATGGAGG - Intergenic
943805262 2:192117104-192117126 ATGTGATTACTGATAGATGGAGG + Intronic
943963725 2:194302764-194302786 ATGACAGGACTGAAAGATTCTGG + Intergenic
945818017 2:214629475-214629497 AAGGCAGTTGTGGAAGATGGAGG + Intergenic
946688560 2:222294514-222294536 ATCTCGGTACTGAAAGACGGAGG + Intronic
1168902110 20:1373791-1373813 ATGGCTGGCATGAAAGATGGGGG + Intronic
1169541298 20:6602755-6602777 ATGGCAGGAAGGAAGGATGGAGG - Intergenic
1169543974 20:6631866-6631888 ATGGCAGTTCTCAAAAAAGGGGG - Intergenic
1170931090 20:20769955-20769977 ATTACAGTTCTTAAAGATGGTGG - Intergenic
1173001157 20:39106691-39106713 ATGGCAGAGCTAAAAGATGGCGG - Intergenic
1174095692 20:48087944-48087966 AAGGCAGGGCTGAGAGATGGAGG - Intergenic
1174125260 20:48299752-48299774 ATGCAGATACTGAAAGATGGTGG + Intergenic
1177411032 21:20730904-20730926 AAGGCAGATCTGAAAGATGAAGG + Intergenic
1178637544 21:34317935-34317957 ATGACAGTACTTCAAGAGGGTGG - Intergenic
1178735971 21:35151534-35151556 AGGCCAGTACTGGAAGAGGGAGG + Intronic
1179406175 21:41127685-41127707 ATGGCAGTACTGTGAGCTGTTGG + Intergenic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1182868712 22:33627463-33627485 ATGGAAGTATTGAATGCTGGAGG - Intronic
1184715676 22:46280470-46280492 ATGGCAGGAGTGAAGGGTGGTGG - Intronic
949090007 3:16170-16192 AAGGCAGAACTGAGAGAAGGTGG - Intergenic
949371041 3:3335091-3335113 CTGGCAGTACTGAGAGATGCAGG - Intergenic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
950202140 3:11052442-11052464 ATGGCAAAACAGATAGATGGAGG + Intergenic
950398797 3:12754346-12754368 ATGGCTGTACAGAAAGAGGATGG + Intronic
952696185 3:36267447-36267469 TTGGGGGTACTGTAAGATGGTGG - Intergenic
958745947 3:98134717-98134739 ATTTCAGTATTGAAAGATGAAGG - Intergenic
964335400 3:155649164-155649186 AGGGCAGTACTGAGATATGTAGG + Intronic
964657227 3:159081113-159081135 ATGGCAGAGCAGCAAGATGGGGG - Intronic
965841919 3:172916151-172916173 ATGGCAAAACTGAAAAATGTAGG - Intronic
970437302 4:16048087-16048109 ATGGGAGTGCTGGAAGGTGGAGG - Intronic
970651977 4:18188869-18188891 AAGGCAGTGCTGTAAGAAGGAGG - Intergenic
971832451 4:31713694-31713716 CTTCCAGTACTGAAAAATGGTGG + Intergenic
972210732 4:36833496-36833518 ATAGGAGCACTGAAAGATGCAGG + Intergenic
972341816 4:38158572-38158594 ATTGCAGGACTGAAAGTAGGTGG - Intergenic
974454285 4:62106051-62106073 GCGGCAGTGCAGAAAGATGGCGG + Intergenic
975856204 4:78627321-78627343 AAGGCAGAGCTGAAAGATGAAGG - Intergenic
975875163 4:78827731-78827753 ATGGCAGAACTGAACAGTGGTGG - Intronic
977922662 4:102662584-102662606 AGTGAATTACTGAAAGATGGTGG - Intronic
982772428 4:159409382-159409404 ATGGCAGTACTGATTTAAGGTGG + Intergenic
984413804 4:179431637-179431659 ATTGCTGGACTGTAAGATGGAGG + Intergenic
984485604 4:180364958-180364980 ATGGCAGTAGTCAAAGAAGATGG - Intergenic
986453682 5:7892990-7893012 ATGACAGTAATGAATGATGTGGG - Intronic
987348719 5:17002029-17002051 AAGGTAGTACTGAAATATGATGG + Intergenic
989491476 5:42060470-42060492 ATGGCAAAACTGAAAGATCTTGG + Intergenic
990678518 5:58215701-58215723 TTGGGATTTCTGAAAGATGGAGG - Intergenic
990928371 5:61056265-61056287 ATGGTATTACTTTAAGATGGGGG - Intronic
991220662 5:64211624-64211646 ATGGATGTGCAGAAAGATGGAGG - Intronic
993551422 5:89278430-89278452 ATGGCAGAAAAGAAAGAGGGAGG - Intergenic
995381400 5:111538303-111538325 AGGGCAGAAATGAAAGAAGGAGG - Intergenic
996428088 5:123336400-123336422 ATGGCAGTAATGAAGAATGGTGG - Intergenic
998575260 5:143308511-143308533 ATGGCAGTACTGAGAGAGAATGG - Intronic
999413934 5:151378674-151378696 GTGGCAGTAATGGCAGATGGTGG - Intergenic
999609090 5:153350169-153350191 ATGGAAGGACTGAGTGATGGAGG + Intergenic
1000877830 5:166663075-166663097 ATAGCAATGCTGAATGATGGAGG - Intergenic
1000951846 5:167493609-167493631 ATGAAAGTACTGAGATATGGAGG + Intronic
1001476089 5:172051927-172051949 AGGGCAGTAAAGAAAGATGTGGG + Intronic
1001517778 5:172367879-172367901 ATGGCAGAGCAGCAAGATGGGGG + Intronic
1002084581 5:176765041-176765063 ATGACAGAAGTGAAGGATGGAGG - Intergenic
1005773250 6:29098911-29098933 AGGTCAGTACTGAAAGAAGTTGG + Intergenic
1005779235 6:29171104-29171126 AGGTCAGTACTGAAAGAAGTTGG + Intergenic
1008441555 6:51537547-51537569 GTGGCAGTGCAGAAAGATGGAGG + Intergenic
1008701794 6:54109640-54109662 AGGGCAGTAATTCAAGATGGTGG - Intronic
1008783023 6:55130092-55130114 ATGAAAGTACTGACAGATGAGGG - Intronic
1009472307 6:64042847-64042869 GTGGAAGTCCTTAAAGATGGTGG - Intronic
1011451982 6:87502819-87502841 ATGGCAGTGCAGACAGATTGAGG - Intronic
1011567176 6:88688590-88688612 AAGGAAGTACTGAAAAATGATGG + Intronic
1014146786 6:118007308-118007330 GTGACAGTATTGAAAGGTGGGGG - Intronic
1014431947 6:121381445-121381467 GTGGCAGTGCAGAAAGATGGCGG - Intergenic
1014783636 6:125592970-125592992 GTGGCAGTCTTGAAAGGTGGGGG + Intergenic
1016130941 6:140469644-140469666 ATGGCAGGACTGAACCATTGTGG + Intergenic
1017657466 6:156643716-156643738 AGGGCAGTGCAGAGAGATGGTGG + Intergenic
1017931369 6:158958569-158958591 GTGGCAGTATTAAAAGGTGGGGG - Intergenic
1019677537 7:2323544-2323566 ATGGCAGAAATGCAGGATGGTGG - Intronic
1020469646 7:8521542-8521564 ATGGCAGCATTGCCAGATGGAGG + Intronic
1020863063 7:13519250-13519272 ATGGCAGGATTGCAAGATGGGGG + Intergenic
1023666554 7:42528402-42528424 ATGGCTGTACTGACAGAAGTAGG + Intergenic
1024171652 7:46793918-46793940 ATGGCAGTACTGACAGGTAGGGG - Intergenic
1028820396 7:95204304-95204326 ATAGCAGTGCTTAAAAATGGAGG + Intronic
1028840222 7:95421452-95421474 ATGGCATTAGTAAAAGATGTTGG - Intronic
1028879247 7:95860913-95860935 ATTGTAGTATTAAAAGATGGGGG - Intronic
1030541712 7:110838448-110838470 ATGGCAGTACTGAAAGATGGGGG + Intronic
1030905406 7:115174934-115174956 ATGGCTGTAAGGGAAGATGGTGG + Intergenic
1032703196 7:134399628-134399650 ATGGCAGGTATGAAAGATGCGGG + Intergenic
1033810587 7:145006445-145006467 ATGGCAGGAAGGAAAGGTGGGGG - Intergenic
1036774654 8:11602240-11602262 AAGGCAGTACTGCATGATGCTGG + Intergenic
1041600716 8:59714387-59714409 ATGCCAATACTGAAAGATGTTGG + Intergenic
1041975673 8:63796544-63796566 ATGGCAATGCTCAAAGATTGGGG + Intergenic
1042807510 8:72787518-72787540 ATGGCAGTTTTAAAAGATTGGGG + Intronic
1043549079 8:81348681-81348703 ATGGCAGGACTGATCCATGGTGG + Intergenic
1044121826 8:88406757-88406779 AGTGCAGTACAGAAAGGTGGCGG - Intergenic
1046644301 8:116768046-116768068 ATGGCTGTAGTTAGAGATGGGGG - Intronic
1049138048 8:140923720-140923742 ATGCCAGTACTAAAAGAGGTTGG - Intronic
1053654037 9:40197508-40197530 GTGGCAGAAAAGAAAGATGGTGG + Intergenic
1053904425 9:42826685-42826707 GTGGCAGAAAAGAAAGATGGTGG + Intergenic
1054530560 9:66178829-66178851 GTGGCAGAAAAGAAAGATGGTGG - Intergenic
1054673781 9:67833454-67833476 GTGGCAGAAAAGAAAGATGGTGG + Intergenic
1054954393 9:70891629-70891651 ATGGAAGTACTGGAAGATAAAGG + Intronic
1055716301 9:79121803-79121825 CTGGCAGGACTGAGAGATGGTGG - Intergenic
1057379586 9:94555739-94555761 GTGGCAGAAAAGAAAGATGGTGG + Intergenic
1058561899 9:106239191-106239213 TTGCCATTACTGAAAGCTGGAGG + Intergenic
1059824651 9:118015611-118015633 AAGGCAGTCCTTAAAGATGAAGG - Intergenic
1060032999 9:120231767-120231789 ATGGTAGTCCTGAGAGAGGGTGG + Intergenic
1061156193 9:128863216-128863238 AGGGCAGTGCTGAGAGACGGGGG + Intronic
1188703889 X:33301833-33301855 ATGATAGTACTAAAAGGTGGAGG - Intronic
1188951012 X:36375185-36375207 GTGGCAATGCGGAAAGATGGCGG + Intronic
1189499887 X:41546549-41546571 ATGTCAATCCTGAAAGGTGGAGG - Intronic
1189882331 X:45505055-45505077 ATGAAAGTACTGTAAGATAGAGG - Intergenic
1191014546 X:55794497-55794519 ATCTCAGTACTGAATGAAGGAGG + Intergenic
1194774111 X:97942164-97942186 ATGGCAGGAGTGTAACATGGGGG + Intergenic
1196728606 X:118920096-118920118 AAGGCAGTACTGATATTTGGGGG + Intergenic
1197428201 X:126324089-126324111 ATGGCTGAAGTGAAAGAAGGTGG + Intergenic
1197761496 X:130031199-130031221 ATGGCAGGACTGGAGGATGCTGG - Intronic
1198299310 X:135319166-135319188 ATGGCAGTAATGAAACTTAGAGG - Intronic
1198730476 X:139722550-139722572 CTGGCAGTTCTGAAAGAGGAAGG + Intergenic
1201507552 Y:14720108-14720130 AAGGCAGTACTGAAAGAATCAGG - Intronic
1201963225 Y:19705658-19705680 ATTGAAGTACAGAAAGAGGGTGG + Exonic