ID: 1030542195

View in Genome Browser
Species Human (GRCh38)
Location 7:110844830-110844852
Sequence CCAGGAAATTTACTGGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030542187_1030542195 8 Left 1030542187 7:110844799-110844821 CCATCTCTGCTTCTCCCACAACC 0: 1
1: 0
2: 10
3: 74
4: 687
Right 1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 108
1030542190_1030542195 -6 Left 1030542190 7:110844813-110844835 CCCACAACCAACTATGGCCAGGA 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 108
1030542191_1030542195 -7 Left 1030542191 7:110844814-110844836 CCACAACCAACTATGGCCAGGAA 0: 1
1: 0
2: 2
3: 13
4: 147
Right 1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 108
1030542186_1030542195 16 Left 1030542186 7:110844791-110844813 CCACATTTCCATCTCTGCTTCTC 0: 1
1: 2
2: 9
3: 117
4: 1070
Right 1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 108
1030542184_1030542195 23 Left 1030542184 7:110844784-110844806 CCCAACTCCACATTTCCATCTCT 0: 1
1: 0
2: 4
3: 47
4: 433
Right 1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 108
1030542185_1030542195 22 Left 1030542185 7:110844785-110844807 CCAACTCCACATTTCCATCTCTG 0: 1
1: 0
2: 4
3: 80
4: 1119
Right 1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030542195 Original CRISPR CCAGGAAATTTACTGGTCAC AGG Intronic
902894624 1:19470659-19470681 CATGGAATTTTACTGCTCACAGG - Intronic
911046061 1:93629356-93629378 CCAGGAAACTTCTTGGTTACCGG + Intronic
911065269 1:93782272-93782294 CCAGGAACATTACTGCTCACAGG - Intronic
919011916 1:191975683-191975705 CCAGGATTTTTACTGGGAACTGG - Intergenic
921600152 1:217098081-217098103 CCATGAAATTAACTGGCCACAGG - Intronic
924125845 1:240850229-240850251 CCAGTAAACTTGCTGGACACAGG - Intronic
1065152939 10:22840731-22840753 CCAGAAAATATGCTGGTCACTGG + Intergenic
1065742443 10:28809156-28809178 CCAGGAGAATTCTTGGTCACAGG + Intergenic
1065777270 10:29132499-29132521 CCAGGAAAATTACGGGTGGCAGG - Intergenic
1066059143 10:31706978-31707000 GCAGCAAATGTACTGGTCCCTGG - Intergenic
1067762670 10:49059745-49059767 CCATAAAATGTACTGATCACAGG + Intronic
1070757812 10:79004375-79004397 TCAGGAAATTTAATGTTCCCGGG + Intergenic
1071319760 10:84442672-84442694 CCAGTTAATTAACTGATCACTGG - Intronic
1074070037 10:110058320-110058342 CTGGGAAATTTCCTGTTCACAGG - Intronic
1074171591 10:110944831-110944853 CTAGGAGATTTACTGGTTCCAGG - Intronic
1074418442 10:113287339-113287361 CGGGGAAATTAACTTGTCACTGG + Intergenic
1089096268 11:115922568-115922590 CCTGGCACTTTACTGGGCACTGG - Intergenic
1090917996 11:131183607-131183629 CTAGGAAATAAACTGGTCATTGG + Intergenic
1098044036 12:66381598-66381620 CCAGGGAATTCAGTGGTCATCGG - Intronic
1099109075 12:78534405-78534427 CCAGGCAATTTTCTAGCCACAGG + Intergenic
1099604302 12:84782734-84782756 CCAGGAAATGTGCTAGTAACTGG - Intergenic
1100625349 12:96325699-96325721 CCAGGGAATGTACAGATCACAGG - Intronic
1104320375 12:127745169-127745191 CCAGGATACTGACTGGTCAGGGG + Intergenic
1106485613 13:30169700-30169722 CTGGGAGATTTACTGGTCACTGG + Intergenic
1108086080 13:46795275-46795297 CCACTTAATTTACTGGTCAACGG + Intronic
1108613130 13:52103747-52103769 CCAGGATTTTTACTGGGGACTGG - Intronic
1109968663 13:69737070-69737092 CCAGGAGATGTACAGGGCACTGG + Intronic
1110594049 13:77298484-77298506 CCAGGAACTTTTCTGGACAGAGG - Intronic
1119989934 14:79185205-79185227 CCAGGAAATTTTCTGAGGACTGG + Intronic
1121897457 14:97661730-97661752 CCTGGAAATTTAGTGGTCTTCGG + Intergenic
1124957415 15:34368254-34368276 CCAGGAAATTTTCTGAGCCCAGG + Intergenic
1125381486 15:39091799-39091821 CCAGGGAATTTGATGGTCCCTGG + Intergenic
1126095775 15:45088920-45088942 CCAGGAAATTTACAGCTCCCTGG + Intergenic
1129066666 15:72910726-72910748 CCAAGAATTTTACTGGTAATAGG - Intergenic
1130876431 15:88018466-88018488 CAAGGTCATTTACTGGTCAAAGG - Intronic
1131340401 15:91595092-91595114 CAAGGAAATTTATTGGTATCTGG - Intergenic
1131647384 15:94359999-94360021 CAAGGAAAGTTACTGGTATCAGG - Intronic
1133378767 16:5312469-5312491 CCACAAAATTTAGTGGTCACGGG - Intergenic
1134539311 16:15052087-15052109 TCAGAAAATCTGCTGGTCACTGG - Intronic
1135589469 16:23694888-23694910 CCAGGAAATATTCTCATCACCGG - Exonic
1140757251 16:78078905-78078927 CCAGGCAATTTACTAGGTACTGG + Intergenic
1144297884 17:13896577-13896599 CCAGGGGATTCACTGGACACAGG - Intergenic
1146481082 17:33205459-33205481 CCAGCAAATTTACTTATCAAAGG + Intronic
1150197707 17:63318060-63318082 GCAGTAAATTTCTTGGTCACTGG - Intronic
1155797912 18:30063923-30063945 CCAGCAAATTTAGTGTTCAGTGG + Intergenic
1159371392 18:67531587-67531609 TTAGGAAAGTTACTGTTCACAGG - Intergenic
1160063704 18:75555027-75555049 CCAGAAAATTTACTTGCCAGTGG + Intergenic
1164152546 19:22567581-22567603 TCAGGAAATATACTTGTCCCTGG - Intergenic
927120698 2:19958520-19958542 TCAGGTACTGTACTGGTCACTGG - Intronic
927378113 2:22442406-22442428 TCAGGAAAACTTCTGGTCACTGG - Intergenic
927477209 2:23423138-23423160 CCTGGGAAGTTCCTGGTCACAGG + Intronic
933009310 2:77037939-77037961 TTAAGAATTTTACTGGTCACTGG - Intronic
935334880 2:102006944-102006966 CCAGGAAGCTTACTGGTCCAAGG + Intronic
941732010 2:168928601-168928623 CCAGTGAATGTTCTGGTCACAGG - Intronic
1171334415 20:24370713-24370735 CCAGGATATTTTCTGAGCACTGG - Intergenic
1173209453 20:41020800-41020822 CCAGGAGAATTAATGGTCATTGG + Intergenic
1176365511 21:6030252-6030274 CCAGGACATTTCCTGGGCTCAGG + Intergenic
1177665116 21:24146702-24146724 CCAGGATATTTAATGCACACAGG - Intergenic
1179758007 21:43508293-43508315 CCAGGACATTTCCTGGGCTCAGG - Intergenic
1181458957 22:23075081-23075103 CCAGGAAGCTGGCTGGTCACAGG + Intronic
1185067123 22:48638197-48638219 CAAGGCAAATGACTGGTCACAGG + Intronic
950682800 3:14596545-14596567 CCATGCAATATACTAGTCACCGG + Intergenic
952246759 3:31602404-31602426 CTTGGAAATTTAATGGTCAGAGG + Intronic
952270485 3:31826141-31826163 GCAGGAAATTTATGGGTCACTGG + Intronic
953193974 3:40714738-40714760 CCAGGAACATCACTGATCACAGG + Intergenic
954479655 3:50787244-50787266 CCAGGGTATTTAATGCTCACTGG - Intronic
956290936 3:67658879-67658901 CCAGGTATTTTCCTAGTCACAGG - Intergenic
956460227 3:69464275-69464297 CCAGGAGGTTTTCTGGTAACAGG + Intronic
956609064 3:71103582-71103604 CCAGGAAATTTTCTAACCACTGG + Intronic
961201206 3:125047203-125047225 CCAGGCATTTTACTGGACAGTGG - Intronic
961735427 3:128999412-128999434 CCAGGAAAGCTACTGTTCAAAGG + Intronic
961831718 3:129626533-129626555 CCAGGGAATTTTCTGGTTGCTGG + Intergenic
962408009 3:135116777-135116799 TCAGGAAATATACTGGTCCTTGG - Intronic
963727367 3:148937409-148937431 CCAGCACATTTGCTGGTGACAGG - Intergenic
964881089 3:161423536-161423558 TCAGGAAGTTTACTTGTTACAGG - Intergenic
966997316 3:185295813-185295835 CCAGGAAATTTCCTAAACACTGG - Intronic
967010940 3:185432933-185432955 CAAGGAAATTTGCTAGTCTCTGG - Intronic
969389519 4:6880476-6880498 CCAGGAACTTTACTGGGCACAGG - Intronic
970772331 4:19628800-19628822 CCAGGACATTTTCTGGGCACTGG + Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
978699817 4:111628601-111628623 CCAGGGAATTTCCTGGTCTGCGG + Intergenic
979931756 4:126640734-126640756 CCAGGAAATGTGCCTGTCACAGG + Intergenic
984282183 4:177683700-177683722 CCAGAAAATGACCTGGTCACAGG - Intergenic
984996733 4:185439225-185439247 CCACAAAATTTACTTGTCATGGG - Intronic
993537885 5:89109476-89109498 CCTGGAGATTTATTGATCACTGG + Intergenic
998019752 5:138759508-138759530 CCAGGAAATTTAATGGGCCAAGG - Intronic
998953091 5:147411608-147411630 CCAGAAAATTTACTAGTTCCTGG + Intronic
999044175 5:148449648-148449670 CCAGGAAATTCCATGGTCCCGGG - Intergenic
999624368 5:153504850-153504872 GCAGGAAATGTCCTGGTCACTGG - Intronic
1004823710 6:19398161-19398183 CCAGGCAATGTTCAGGTCACAGG - Intergenic
1005636840 6:27761036-27761058 CCAGGAAGATAATTGGTCACAGG + Intergenic
1012414774 6:99001447-99001469 CCAGGAAATTGACCGCTCCCTGG + Intergenic
1013191851 6:107810330-107810352 CCAGGAAAATCACTGGTCCTAGG + Intronic
1014677597 6:124386365-124386387 CCATGACATTTACTGTTGACTGG + Intronic
1015049789 6:128826345-128826367 CCAGGTACTTTTCTGGACACTGG + Intergenic
1018803721 6:167242526-167242548 CCCGGAAATTTTCTGCCCACTGG + Intergenic
1018891415 6:167985864-167985886 GCAGGAAATTCTCTGGTCGCTGG + Intergenic
1023574450 7:41611112-41611134 CCATGAAATTTACTTTCCACTGG - Intergenic
1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG + Intronic
1034074075 7:148214930-148214952 CAATGAAATTTAGTGGGCACGGG - Intronic
1037994942 8:23345286-23345308 CCAGGCAATGTATTGGACACAGG - Intronic
1039000200 8:32971505-32971527 CCAGGAAACTTCCTGGTTAATGG - Intergenic
1042554849 8:70025424-70025446 GCAGGGATTTTACTGGTCTCCGG - Intergenic
1042690245 8:71490269-71490291 TCAGGAAATTTTGTGGTCAGTGG - Intronic
1045841084 8:106582088-106582110 TTAGAAAATTTACTAGTCACTGG - Intronic
1047247729 8:123159323-123159345 ACAGGGAACTGACTGGTCACAGG + Intergenic
1048327931 8:133453074-133453096 CCAGGATATTTAATGTGCACAGG - Intergenic
1049876286 8:145023734-145023756 CCAGTAAATTCACTTATCACAGG - Intergenic
1051424069 9:16916393-16916415 ACAGGCAATTTACTGCCCACTGG + Intergenic
1052029039 9:23607708-23607730 CCAGGAAGTGTGCTGGGCACTGG + Intergenic
1056055031 9:82812886-82812908 ACAGGTAATTTTCAGGTCACAGG - Intergenic
1058069203 9:100584360-100584382 CCAGAAAATTTACTGGTTTGTGG + Intronic
1185465030 X:349322-349344 GCAAGACATTTACTGTTCACAGG - Intronic
1185826505 X:3256296-3256318 CCCAGAATTTTCCTGGTCACTGG - Intergenic
1187156414 X:16724295-16724317 CCAGGACTTTTACTGGGGACTGG + Intronic
1188424646 X:30032247-30032269 CTAGTTAATATACTGGTCACTGG + Intergenic
1190731331 X:53227956-53227978 CCAGCAAATTTTCTGGGCACTGG + Intergenic
1194035578 X:88867113-88867135 TCAGGAAGTTTGCTTGTCACTGG + Intergenic
1194454488 X:94085334-94085356 CCAAAAAATTTACTGGTGCCTGG - Intergenic
1195725739 X:107914208-107914230 CCAGGCACTGTACTGGGCACTGG - Intronic