ID: 1030547411

View in Genome Browser
Species Human (GRCh38)
Location 7:110914095-110914117
Sequence GGTCCAGGAAGAGCAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030547411_1030547413 -8 Left 1030547411 7:110914095-110914117 CCTGCTTTTGCTCTTCCTGGACC 0: 1
1: 0
2: 2
3: 34
4: 326
Right 1030547413 7:110914110-110914132 CCTGGACCACGTCCGCATCTTGG 0: 1
1: 0
2: 0
3: 19
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030547411 Original CRISPR GGTCCAGGAAGAGCAAAAGC AGG (reversed) Intronic
900437667 1:2639295-2639317 GGTCCAGGAGGAGCCTCAGCGGG + Intronic
901230061 1:7636783-7636805 GGTCTAGGGAGGGCACAAGCAGG + Intronic
903990660 1:27266200-27266222 GGTAGAGGAAGAGGAAAAGTAGG - Intronic
904047586 1:27617832-27617854 AGTGCAGGAAGAGCAGTAGCCGG - Intronic
904843133 1:33387111-33387133 GGTGGAGGAAGAGAAAAAGAAGG - Intronic
904977908 1:34472626-34472648 GGTCCAGGAAGAGGAATCGGGGG + Intergenic
906561475 1:46761164-46761186 GGTGGAGGGAGAGCATAAGCTGG + Intronic
910096237 1:83525344-83525366 GGACCAGAAAGAGCAAAACAAGG - Intergenic
910397778 1:86808968-86808990 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
910524352 1:88160823-88160845 GCTCCAAGAAGAGGAGAAGCGGG + Intergenic
911130052 1:94378101-94378123 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
911425158 1:97700389-97700411 GGTCCAGGAAAAACAAAAACTGG + Intronic
912520844 1:110243674-110243696 GGAGCAGGGAGAGAAAAAGCAGG + Intronic
913533025 1:119746597-119746619 GGTGGAGGCAGGGCAAAAGCTGG + Intergenic
915267371 1:154728689-154728711 GGTGCAGGGAGAGGTAAAGCTGG + Intronic
915368024 1:155326177-155326199 GGTAGAGGAACAGCATAAGCAGG - Intronic
915591487 1:156873606-156873628 GGGCCAGAAAGAGCAACAGCAGG - Intronic
915915643 1:159938949-159938971 GGTGCAGGAAGAGAAAAGGAAGG - Intronic
916536723 1:165710340-165710362 GGTCCAGGAGGAGAACAAGCAGG + Intergenic
918105945 1:181415391-181415413 GGTCCATGAAGAGGTAAACCAGG + Intronic
919372855 1:196752137-196752159 GGTCCAATGAAAGCAAAAGCAGG - Intergenic
919898273 1:202023418-202023440 GCTCCAGGCGGAGCAAATGCTGG + Intergenic
920294785 1:204949263-204949285 GGTGCAGGAAGAGCCACAGCAGG - Intronic
920316366 1:205078202-205078224 GGTCCAAGCAGAGCACAGGCAGG + Exonic
1062846599 10:711964-711986 GGTGAAGGAGGAGCAAAGGCAGG - Intergenic
1063859342 10:10290924-10290946 AGTACAGGAAAAGCACAAGCTGG + Intergenic
1064416532 10:15154835-15154857 GGTCCAAGAATGGCAAGAGCAGG - Intronic
1067296535 10:44978000-44978022 GGGCCACGGAGAGCAGAAGCCGG + Exonic
1070753542 10:78977680-78977702 GGTCCAGGAAGACCCACAGAGGG - Intergenic
1074413753 10:113249481-113249503 AGTCCAGGTAGAGAAAAGGCTGG + Intergenic
1077035968 11:494661-494683 CGTCCAGGGAGAGCAGCAGCAGG + Exonic
1077735994 11:4791602-4791624 GCAACAGTAAGAGCAAAAGCTGG - Intronic
1078746621 11:14121525-14121547 GGTGCAGGAAAGGCAAAAGATGG + Intronic
1079333526 11:19552235-19552257 GGGCTGGGAAGAGCAAGAGCTGG + Intronic
1081145762 11:39561491-39561513 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1081421157 11:42875683-42875705 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1083200914 11:61120559-61120581 GGTCCTGGAACAGCAGCAGCTGG + Intronic
1083848695 11:65352610-65352632 GGTCCAGGAAGAACAAAAAGGGG - Exonic
1084864031 11:72041288-72041310 GGTCCACGAACAAGAAAAGCAGG + Intronic
1085639044 11:78179750-78179772 GGTCTAGGGACAGCAAAGGCAGG - Intronic
1085780109 11:79400527-79400549 GTTCCAGGAAGAGCACAGGGAGG - Intronic
1086503181 11:87474251-87474273 AGACCAGGAATAGCAACAGCAGG - Intergenic
1086555392 11:88104203-88104225 AATCCAGGAATAGCAAATGCCGG - Intergenic
1086965601 11:93024621-93024643 GGTCAAGAAGGAGGAAAAGCAGG + Intergenic
1087053002 11:93905163-93905185 GGTCTGGGAAAAGCAAGAGCTGG - Intergenic
1087074770 11:94118978-94119000 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1087811707 11:102615660-102615682 GGTGCAGGAAGGGCAATGGCAGG - Intronic
1088492302 11:110400189-110400211 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1093349416 12:18079604-18079626 GATCCTGGAACAGCAAAATCTGG - Intergenic
1094753441 12:33439564-33439586 GGTACGGGAAGAGGAAAAGACGG - Exonic
1095781998 12:46070812-46070834 TGTCCAGGAAGAGGAAGAACTGG - Intergenic
1097474119 12:60033155-60033177 GGCAGAGGAAGAGCAAAGGCAGG + Intergenic
1098012228 12:66065814-66065836 GTTGAAGGAAGAGCAAAGGCTGG - Intergenic
1098188246 12:67921318-67921340 GGGCTAGGAAGAGCAAGAGATGG + Intergenic
1099414989 12:82373743-82373765 AGTACAGGAAAAGCAGAAGCTGG + Intronic
1100051005 12:90447578-90447600 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1100091562 12:90978172-90978194 GGCCCAGGAAGAGGAAGAGGAGG - Exonic
1100530553 12:95457571-95457593 AGTGCAGGAAAAGCAGAAGCTGG + Intergenic
1101318372 12:103650425-103650447 GGTACAGGAGGAGTAAAATCAGG - Intronic
1101335715 12:103794820-103794842 GGTCCAGGGAGAGGAAGAGGAGG + Intronic
1104412467 12:128570729-128570751 GTTCCAGGTAGAGCAAATGGAGG + Intronic
1104644717 12:130488759-130488781 GGTCAGGGAAGAGCAGAAACTGG + Intronic
1105408882 13:20153268-20153290 GTTCAAGCAAGAGGAAAAGCAGG + Intronic
1105853437 13:24355511-24355533 GGTGAAGGAAGAGACAAAGCGGG + Intergenic
1106431790 13:29687824-29687846 GCTCCAGGGCCAGCAAAAGCAGG + Intergenic
1106879044 13:34109283-34109305 GGACTAGGAAGAAAAAAAGCAGG + Intergenic
1108458572 13:50642177-50642199 GTTCCATGATGAGCAAATGCAGG - Intronic
1108499219 13:51054132-51054154 GGTCGAGGGAGATCAAACGCTGG + Intergenic
1109424074 13:62149688-62149710 AGTGCAGGAAAAGCAGAAGCTGG - Intergenic
1110752198 13:79127819-79127841 GTTCCAGGAAGAGCAAACAGTGG + Intergenic
1110922768 13:81109888-81109910 GGTCCAGGAAAAGCTTAAGCAGG - Intergenic
1111623209 13:90750358-90750380 GGAACAGAAAGAGGAAAAGCAGG - Intergenic
1111627871 13:90813042-90813064 CATGCAGGATGAGCAAAAGCAGG + Intergenic
1113498703 13:110755662-110755684 TGTCTAGGAAGAGCAAAGACAGG - Intergenic
1113856808 13:113450999-113451021 GGTCCAGCAGTAGCAAAAGGTGG - Intronic
1116182077 14:41547533-41547555 GGTAAAGCAAGAGAAAAAGCTGG + Intergenic
1116837660 14:49786735-49786757 GGAACAGGAAGAGCAAGATCTGG - Exonic
1117285862 14:54285304-54285326 TGTCCAGGAACTCCAAAAGCAGG + Intergenic
1117540899 14:56745695-56745717 GGTCCAGGAGGAGAAAGAGCCGG - Intergenic
1117550464 14:56831158-56831180 GGTCAATGAACAGCAATAGCAGG - Intergenic
1117689179 14:58287775-58287797 GGTCCAGTCAAAGCAAAAGCAGG - Intronic
1117854307 14:60011194-60011216 GATGAAGGAAGAGCAAAAGCAGG + Intronic
1119475114 14:74922734-74922756 GGACCTGGGAGAGCAAAGGCGGG - Intronic
1121000178 14:90446253-90446275 ATTCCAGGAAGAGAAAGAGCAGG + Intergenic
1121678523 14:95773788-95773810 GGACCAGCAAGAGCAAACGCAGG - Intergenic
1122189031 14:100025315-100025337 GTTCAAGGAACAGCACAAGCTGG - Intronic
1124545694 15:30624943-30624965 GGCCCTGGAAGAGGAAAGGCAGG - Intronic
1124779214 15:32614329-32614351 GGCCCTGGAAGAGGAAAGGCAGG - Intergenic
1128746278 15:70116723-70116745 GTTCAAGGAAGAGCAGATGCAGG + Intergenic
1129260190 15:74361986-74362008 GGTCCAGGAATGGCAAGACCAGG + Intronic
1131232113 15:90666864-90666886 TGTCCAGGGGGAGCCAAAGCAGG + Intergenic
1131624634 15:94104498-94104520 GGTGAAGGAGGAGCAAAGGCAGG - Intergenic
1131993083 15:98109323-98109345 GATCCAGGAAGCACATAAGCAGG + Intergenic
1132223380 15:100122181-100122203 AATACAGGAAGAGCAGAAGCAGG - Intronic
1132438371 15:101832612-101832634 GGTCCAGTCAAAGCAAAAGTGGG + Intergenic
1132608688 16:804411-804433 GGTCCTGGAAGGACAGAAGCAGG + Intergenic
1133805469 16:9123406-9123428 GGCCCAGGAAGAGGAAAAATAGG - Intergenic
1135407049 16:22206269-22206291 GGTCTAGGTTGAGCAGAAGCGGG - Exonic
1135490039 16:22901178-22901200 TGGCCAGGAAAAGGAAAAGCTGG + Intronic
1138028700 16:53542135-53542157 GGACAAGGCAGGGCAAAAGCTGG - Intergenic
1138244150 16:55454075-55454097 GGTCCAGGCAGGGCACAAGGAGG - Intronic
1138561085 16:57801582-57801604 TGTTCAGGCAGAGGAAAAGCCGG + Intronic
1139375679 16:66495052-66495074 GTTTCAGGGAGAGCAAAGGCAGG - Intronic
1140151790 16:72374878-72374900 AGGCCAGGAAGAGGAAAAGGAGG + Intergenic
1141015684 16:80446983-80447005 GGTCCAGGAAGAGGAAATGATGG + Intergenic
1141032161 16:80598506-80598528 GGTCAATGAAGAACAAAAGGAGG + Exonic
1141077139 16:81016954-81016976 GCTCCAGGCAGAGGAACAGCTGG + Intronic
1143016867 17:3895444-3895466 GGGGCAGAAAGTGCAAAAGCAGG + Intergenic
1143284330 17:5777859-5777881 TATCCAAGAGGAGCAAAAGCAGG + Intronic
1144230585 17:13199192-13199214 GGGTCAGGAAAAGGAAAAGCAGG + Intergenic
1144562200 17:16330034-16330056 GTTCCAGAAGGAGCAAAAGCAGG + Intronic
1145831792 17:27922172-27922194 TCTCCAGGAAGGGGAAAAGCAGG - Intergenic
1146492449 17:33292475-33292497 GGTCCAGGACGAGGGAAGGCGGG - Exonic
1146572212 17:33962434-33962456 GTTCCAGGAAAAGAAAAAGCTGG + Intronic
1147199138 17:38788107-38788129 GCTCAAGGAAGAAAAAAAGCTGG + Intronic
1149659318 17:58326134-58326156 GGTGCAGGAAGGGCAGAGGCTGG - Intronic
1150449702 17:65256609-65256631 GATACAGGAAGAGCAAAGCCTGG - Intergenic
1150557182 17:66264879-66264901 GGTGAAGGAGGAGCAAAGGCAGG - Intergenic
1152071946 17:78138417-78138439 GGCCCAGGAGGAGCACTAGCTGG - Exonic
1152376815 17:79922815-79922837 GGGCCTGGGAGAGCAAAGGCTGG - Intergenic
1153987836 18:10368821-10368843 GGAGGAGGAAGAGAAAAAGCGGG + Intergenic
1155069191 18:22298467-22298489 GTTCCAGGAAGGGGAAGAGCAGG - Intergenic
1155266962 18:24103777-24103799 AGGGCAAGAAGAGCAAAAGCAGG - Intronic
1155480867 18:26286110-26286132 GGTCCAGTGGGAGCAAAAGCTGG + Exonic
1155935398 18:31747738-31747760 GGTCCAGCAAGAGCAGCATCTGG + Intergenic
1156374489 18:36501264-36501286 GGCCCAGGCAGAGCTAAGGCTGG + Intronic
1156416706 18:36901575-36901597 GGTCCACAAAGACCAAAAACTGG - Intronic
1158668763 18:59455963-59455985 GGGCCAGGAAGAACAAGAGATGG - Intronic
1159565385 18:70042320-70042342 CTTCCAGGAAGAGAAAAACCAGG + Intronic
1160254448 18:77235954-77235976 GGTGCAGAAAGAGCAGAAGGTGG - Intergenic
1160527129 18:79544568-79544590 GGCCCAGGAAAAGGAAAAGCGGG - Intergenic
1163020737 19:14479735-14479757 GGGCCAGGAATAGGAAATGCTGG + Intronic
1163497701 19:17656193-17656215 GGACCAGGATGAGGAAGAGCTGG - Exonic
1164147413 19:22520444-22520466 GGTGAAGGAAAAGGAAAAGCGGG - Intronic
1164993222 19:32699465-32699487 AGTACAGGAAAAGCAGAAGCTGG + Intronic
1165313747 19:35042544-35042566 GCGCCAGGCAGAGCCAAAGCTGG - Intronic
1165694284 19:37888705-37888727 GGCCCAGGAAGAGAGAAAACTGG - Exonic
1165846853 19:38823600-38823622 AGTACAGGAAAAGCAGAAGCTGG - Intronic
1166182567 19:41119217-41119239 GGTCCAGGAAGAGAAGAGACGGG + Intronic
1166294513 19:41882607-41882629 GGCCCAGGCACAGCAACAGCTGG + Intergenic
1167431418 19:49457128-49457150 GGGCCAGTAAGAGAAAAATCAGG + Intronic
925008828 2:467248-467270 GTCCCAGGAAGAGAAGAAGCTGG - Intergenic
925480315 2:4263278-4263300 GGTCAGGGAAGAGACAAAGCTGG - Intergenic
925864949 2:8219471-8219493 GGTCCTTGAACAGCAATAGCAGG + Intergenic
925894005 2:8457355-8457377 GGCCCAGGGAGCGCAGAAGCCGG - Intergenic
926885104 2:17589937-17589959 GGAACAGGAAGAGCGAAAGCAGG - Intronic
927240600 2:20916891-20916913 GGAACAGCAAGAGCAAAACCTGG + Intergenic
927964696 2:27261967-27261989 GGTGGGGGAAGAGAAAAAGCCGG + Intronic
928501103 2:31896433-31896455 AGTTCAGGTAGAGAAAAAGCAGG + Intronic
929389360 2:41451397-41451419 GGTCCAGGCAAAGCAAAAGCAGG + Intergenic
930038244 2:47101286-47101308 AGTACAGGAAAAGCAGAAGCTGG - Intronic
932411751 2:71551630-71551652 TCTCCAGGGAGAGCAGAAGCCGG - Exonic
933155408 2:78967587-78967609 GCTCACGGAAGAGCAAGAGCTGG + Intergenic
933341905 2:81035970-81035992 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
933472337 2:82742045-82742067 GATGGAGGAAGAGCAAAAGAGGG - Intergenic
933587557 2:84195842-84195864 GGCCCAGGAAGAATAAAACCTGG - Intergenic
933738795 2:85516784-85516806 TGTGCAGGAAGGGCCAAAGCCGG - Intergenic
934051497 2:88215082-88215104 GGTCCATGAACAGCAAGAGGTGG - Intergenic
934556552 2:95289688-95289710 GGGCCAGGAAGGGCATAAGAGGG - Exonic
937070704 2:119060991-119061013 GGTCCAGGCAGACAGAAAGCTGG - Intergenic
937365288 2:121256973-121256995 GGTCCAGTAAGAGCTTCAGCAGG + Intronic
937554575 2:123137804-123137826 TGTCCCAGAAGAGCAAAAACTGG + Intergenic
937955499 2:127419863-127419885 GGTGCAGGCAGAGCAGCAGCGGG + Intronic
938235260 2:129700716-129700738 GGTCCAGGAAGAGCGGGGGCTGG - Intergenic
938293697 2:130163738-130163760 GCTCCAGGAACGGCAACAGCAGG + Intronic
938777354 2:134553701-134553723 GTGCCAGTAAGAGCAACAGCAGG - Intronic
938841095 2:135164637-135164659 GGTGCAGGAAGAGGACATGCTGG + Exonic
939000808 2:136731769-136731791 GGGCCAGGGAGAGAAATAGCTGG + Intergenic
939658706 2:144860364-144860386 GGACCAGAAAAAGCAAAGGCGGG - Intergenic
941482967 2:166040800-166040822 GATCCTGGAAGAGGAAAAGCTGG + Intronic
943064508 2:183072004-183072026 GGGCCAGGAAAAGCTGAAGCTGG - Intergenic
944081920 2:195797642-195797664 AGTCCAGGAAGAGCAATGGTGGG - Intronic
945485352 2:210388909-210388931 GGTCCAGCAATCACAAAAGCAGG - Intergenic
945564294 2:211377459-211377481 CGTCCATAAAGAGCAAAAGTAGG + Exonic
949000544 2:241610500-241610522 GCTCCAGCAAGAGCAGAGGCGGG + Intronic
1168954471 20:1825220-1825242 GGTCCAGAGAGAGGAAGAGCAGG + Intergenic
1169647876 20:7833835-7833857 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1171348297 20:24483518-24483540 AGTACAGGAAGAGCAAACACTGG - Intronic
1172637590 20:36420441-36420463 GGATCAGGTAGGGCAAAAGCAGG + Intronic
1172858924 20:38032351-38032373 AGTGCAATAAGAGCAAAAGCAGG + Intronic
1173554792 20:43958443-43958465 GGTCCAGAGTGAGCAAAGGCTGG - Intronic
1173988451 20:47280899-47280921 GGACCAGGAAGAGCAGAGGTCGG - Intronic
1174520703 20:51128312-51128334 GGCCCAAGAAGAGCAAAAAAGGG - Intergenic
1174956648 20:55105567-55105589 GGTGAAGGAGGAGCAAAAGCAGG - Intergenic
1175407078 20:58741848-58741870 GGCCCAGGCAGAGAAAGAGCAGG + Intergenic
1175738817 20:61406295-61406317 GGTCCAGGCAGAGCAGATGCTGG - Intronic
1175738825 20:61406337-61406359 GGTCCAGGCAGAGCAGATGGTGG - Intronic
1175738843 20:61406428-61406450 GGTCCAGGGAGAGCAGATGGTGG - Intronic
1175738858 20:61406505-61406527 GGTCCAGGCAGAGCAGATGGTGG - Intronic
1175738876 20:61406596-61406618 GGTCCAGGCAGAGCAGATGGTGG - Intronic
1175738890 20:61406666-61406688 GGTCCAGGGAGAGCAGATGGTGG - Intronic
1175738906 20:61406743-61406765 GGTCCAGGCAGAGCAGATGGTGG - Intronic
1175738938 20:61406897-61406919 GGTCCAGGCAGAGCAGATGGTGG - Intronic
1175738947 20:61406946-61406968 GGTCCAGGCAGAGCAGACGGAGG - Intronic
1175738951 20:61406967-61406989 GGTCCAAGAAGAGCAGATGGTGG - Intronic
1175738959 20:61407009-61407031 GGTCCAGGCAGAGCAGATGGTGG - Intronic
1175891171 20:62316677-62316699 GCTCCAGGAACAGCAGAGGCTGG - Exonic
1177831006 21:26138885-26138907 GGTCAAAGAAGAGGAAAAGGAGG + Intronic
1177966209 21:27730000-27730022 GGTGAAGGAAGAGGAAAAGGAGG + Intergenic
1178785453 21:35649263-35649285 GGTCCAGGAAAAGAGAAGGCAGG - Intronic
1179610256 21:42545655-42545677 AGTCCAGGAAGAGCCATATCAGG + Intronic
1179635131 21:42703910-42703932 GTGCCAGGATGAGAAAAAGCAGG + Intronic
1182063786 22:27416550-27416572 GGGGCAGGAAGAGCAACATCAGG + Intergenic
1182075632 22:27493587-27493609 GGTCCATGATGAGCAAGAGGGGG - Intergenic
1182445221 22:30386087-30386109 GGTTCAGGATGAGAAGAAGCAGG + Exonic
1182911732 22:33990099-33990121 AGTCAAGGGAGAGAAAAAGCTGG - Intergenic
1183103234 22:35596825-35596847 AGTCCAGGAACAGCAAACCCAGG + Intergenic
1183931396 22:41237967-41237989 GGCGCAGGAAGAGGAAGAGCTGG - Exonic
949537892 3:5009985-5010007 GGTCCAGGGAGAGCAGAACCAGG + Intergenic
949767080 3:7538449-7538471 GGAGCAGGAACAGCTAAAGCAGG - Intronic
950141285 3:10617804-10617826 GGACCAGGAAGACGCAAAGCTGG + Intronic
951860313 3:27244723-27244745 AGTCCAGGAACTGCACAAGCAGG - Intronic
953137379 3:40193012-40193034 AGTCCAGGAAAAACAAAAACTGG - Intronic
953138973 3:40210072-40210094 TGTCCAGGAAGAGCTGAAGAAGG + Exonic
954232523 3:49228281-49228303 AGTACAGGAAAAGCAGAAGCTGG + Intronic
954872271 3:53776815-53776837 GGTCCAGGAACAGTACCAGCTGG - Intronic
956551592 3:70466826-70466848 GGGCCAGGAAGGGCAAAACCTGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
961313134 3:126016463-126016485 GACCCAGGAAGAGCCAAAGCTGG - Intronic
961319673 3:126063994-126064016 TGTCCAGGAAGGGCAACAGAGGG - Intronic
961425141 3:126839282-126839304 GGTTTAGGAAGAGTACAAGCAGG + Intronic
961518447 3:127453088-127453110 AGGCCAGGAAGAGCAAAACAGGG + Intergenic
962277647 3:134028498-134028520 GGTGCGGAAAGAGCAGAAGCAGG + Intronic
963760795 3:149285385-149285407 AGTACAGGAAAAGCAAAAGCTGG - Intergenic
964006262 3:151832945-151832967 GGAACAGGAGGAGCAACAGCAGG + Intergenic
965055406 3:163706768-163706790 TGTCCAGAAAAAGCAAATGCTGG - Intergenic
965062477 3:163802370-163802392 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
965642495 3:170844899-170844921 TGTCCAGAAAGAGGAAAAGTAGG + Intronic
967367837 3:188707859-188707881 GCTGCAGGAAGAGCAAAATAAGG - Intronic
968312767 3:197697658-197697680 GGGACAGGAAGAGCGAGAGCTGG + Intronic
968834116 4:2950165-2950187 TGTCCAGGAAGAGCAAAGCAAGG - Exonic
971142045 4:23934813-23934835 GATCCAGGAAGTGAATAAGCAGG + Intergenic
973045603 4:45532162-45532184 AGTACAGGAACAGCAGAAGCTGG - Intergenic
973096153 4:46202703-46202725 GGTGAAGGAAGAGCAAAGGCAGG + Intergenic
973158622 4:46989761-46989783 GCCCCACGAAGAGCAGAAGCAGG + Intronic
974187043 4:58458881-58458903 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
974200625 4:58635162-58635184 GGTTCAGAAAGAGCAAATGTAGG + Intergenic
974972026 4:68842512-68842534 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
975103057 4:70536226-70536248 GGTCCAGTCAAAGCAAAAGTGGG - Intergenic
975815221 4:78210130-78210152 GTTCCAGGAAGAGGAAGTGCAGG - Intronic
976369450 4:84270076-84270098 GGTCCAGGAAAAGGCTAAGCAGG + Intergenic
977192041 4:94013058-94013080 GATGAAGGAAGAGCAAAGGCAGG - Intergenic
977196309 4:94065154-94065176 GGTCAAAGAGGAGCCAAAGCAGG + Intergenic
978399025 4:108311706-108311728 GGTCCAGGATAATCAAAATCTGG - Intergenic
978758214 4:112326873-112326895 GCTCCAGGAAGAGGAAGAGTGGG + Intronic
980291170 4:130848500-130848522 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
984762528 4:183375398-183375420 GGTCCAGAAAAAGCCACAGCAGG + Intergenic
985347940 4:189026645-189026667 GGTCCAGTGAGAGCAAAACCAGG + Intergenic
986128005 5:4901538-4901560 AGTCCAAGAAGAGTATAAGCTGG - Intergenic
987309714 5:16670681-16670703 GGTCGAGGAGGAGCAGATGCTGG - Exonic
987929614 5:24387824-24387846 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
988850229 5:35173376-35173398 GGCTGAGGAAGAGAAAAAGCAGG - Intronic
989476534 5:41880770-41880792 GGTCCAGAAAGACCAAAAGTGGG + Intergenic
990116460 5:52398015-52398037 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
991189235 5:63849268-63849290 AGCCCAGGATGAGCCAAAGCTGG - Intergenic
991480756 5:67076669-67076691 AGCCCAGGAAGTGCCAAAGCAGG - Intronic
991950744 5:71944757-71944779 AGTACAGCAAAAGCAAAAGCAGG - Intergenic
992116008 5:73539181-73539203 GGTCCATCAAGAGGAAAAGGGGG - Intergenic
993954439 5:94215152-94215174 GGTCAAGGAAAAGGAAAAGAAGG + Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
996839132 5:127827360-127827382 GGCCCAAGAAAAGCAAATGCTGG - Intergenic
996908589 5:128631147-128631169 AGTCCAGCTAGAACAAAAGCAGG - Intronic
997716891 5:136049197-136049219 GGGGCAGGAAGAGGAAAGGCAGG + Intronic
998750576 5:145317430-145317452 GGCTCAGGAACAGCACAAGCTGG - Intergenic
999003785 5:147953569-147953591 GGTCCAGGAAGATGAAAAGATGG + Intergenic
1000084952 5:157880718-157880740 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1003318510 6:5032914-5032936 GGTCAAGGAAGAGCAGCAGGAGG - Intergenic
1003947094 6:11085911-11085933 GGCTCAGGAGGAGGAAAAGCAGG + Intergenic
1004497201 6:16175748-16175770 AGTCAAGGAAAAGCAATAGCAGG + Intergenic
1004531099 6:16456484-16456506 AGTGCAGGAAAAGCAGAAGCTGG - Intronic
1004879956 6:19997487-19997509 GATCCAGAAGGATCAAAAGCAGG + Intergenic
1005149071 6:22727340-22727362 GGCCAAGGAAGAGGAAAAGGGGG + Intergenic
1005315370 6:24598491-24598513 GGGCCAGGAAAAGCTGAAGCTGG + Intronic
1007029744 6:38617186-38617208 AGTGCAGGAAAAGCAGAAGCTGG - Intronic
1008202892 6:48614478-48614500 GTTCCAGGAAGAGCGGAAGAAGG - Intergenic
1008587291 6:52961326-52961348 AGTACAGGAAAAGCAGAAGCCGG + Intergenic
1009400393 6:63247897-63247919 GGTACAGGATGAGGAAGAGCAGG + Intergenic
1009872499 6:69468942-69468964 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1012474474 6:99604788-99604810 GGCCCATGAATGGCAAAAGCCGG - Intergenic
1012691479 6:102318753-102318775 GGTCCCAGAAGAACAAAAGCTGG - Intergenic
1012997349 6:105986560-105986582 CGTCCGGGGCGAGCAAAAGCAGG - Intergenic
1013664962 6:112338454-112338476 AGGCCAGGAAAAGCCAAAGCTGG - Intergenic
1014152239 6:118071309-118071331 ACTCCAGGAAAAGCAAAAGGTGG - Intronic
1014609440 6:123523062-123523084 GTGCTTGGAAGAGCAAAAGCTGG + Intronic
1015256333 6:131183435-131183457 GGTCCAGGAAGAACAAAAAGGGG + Intronic
1016183740 6:141176882-141176904 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1018130231 6:160723251-160723273 GGGACATGAAGAACAAAAGCAGG + Intronic
1018984928 6:168629133-168629155 ACTCCAGGAACAGCAAAGGCAGG - Intronic
1019720694 7:2568796-2568818 GGTCCAGGAACAGGACACGCAGG - Intronic
1021356870 7:19660392-19660414 AGTACAGGAAAAGCGAAAGCTGG + Intergenic
1022607121 7:31826237-31826259 GGCCCAGGTAGAGGTAAAGCTGG + Intronic
1022850341 7:34255383-34255405 GGTCAAGGAAGAGGAAAGGAAGG + Intergenic
1023078225 7:36503955-36503977 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1023151330 7:37203884-37203906 AGTACAGGAAAAGCAGAAGCTGG + Intronic
1023222908 7:37938612-37938634 GGTCCAGTTAAAGCAAAAGCAGG - Intronic
1023470342 7:40510946-40510968 GCTCCAGGAAGAGAAAACACAGG + Intronic
1024389721 7:48794344-48794366 GGACTAGGAAGGCCAAAAGCAGG + Intergenic
1024644286 7:51358228-51358250 GGTTCAGGACGAGCTAAAGCTGG - Intergenic
1024735001 7:52295610-52295632 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1024989577 7:55222694-55222716 GGTCCTGGAAAAGCTAAAACCGG + Intronic
1027790835 7:82637805-82637827 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1028267700 7:88748038-88748060 GGTCCAGGAAAAGTAGAAGAGGG + Intergenic
1029464505 7:100716764-100716786 GGTCCTGGGAGAGCAGAGGCTGG + Intergenic
1030420230 7:109299918-109299940 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1030547411 7:110914095-110914117 GGTCCAGGAAGAGCAAAAGCAGG - Intronic
1030737129 7:113062559-113062581 GGTCCAGGCAAAGCAAAAGCAGG + Intergenic
1034335346 7:150319563-150319585 GGTCCAGGAAGAGTTAGGGCAGG + Intronic
1034889866 7:154830310-154830332 GTTCCAGGAAGAGGCAGAGCCGG + Intronic
1035250807 7:157595717-157595739 GGTTCAGGAAGAGGGAAAGGTGG + Intronic
1035495614 7:159323041-159323063 GGTCCAGGAATAGCACCAGATGG + Intergenic
1035834087 8:2729277-2729299 GGTCCAGCCAAAGCAAAAGTGGG - Intergenic
1036224224 8:6944487-6944509 GGTCCAGGAAAAGGGAGAGCAGG + Intergenic
1036228852 8:6982741-6982763 TGTCCAGGAAGAGGGAGAGCGGG + Intergenic
1036231304 8:7001851-7001873 TGTCCAGGAAGAGGGAGAGCGGG + Intronic
1036233755 8:7020947-7020969 TGTCCAGGAAGAGGGAGAGCGGG + Intergenic
1037109992 8:15154370-15154392 TGACCAGGCTGAGCAAAAGCTGG - Intronic
1038411632 8:27363639-27363661 GGTCCATGATGAGAAAAAGGAGG - Intronic
1038638504 8:29305770-29305792 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1039999986 8:42567525-42567547 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1040971743 8:53142776-53142798 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1040971746 8:53142803-53142825 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1041538075 8:58950836-58950858 GGTGCAGGCATGGCAAAAGCTGG + Intronic
1042731496 8:71939814-71939836 TGTCAAGCAAGAGCCAAAGCAGG - Intronic
1045443238 8:102236093-102236115 GGACAAGGAAAAGCAAAAGTAGG + Intronic
1045680844 8:104658291-104658313 GCACCAGGAAGACCCAAAGCTGG + Intronic
1046150772 8:110221566-110221588 GCTTCAGGAAAAGGAAAAGCAGG + Intergenic
1047624782 8:126645511-126645533 TGTCCAGGAAGAGCAGGAGAGGG - Intergenic
1048560916 8:135536599-135536621 GGTCCAGGGAGAGCAGATGAGGG + Intronic
1048859642 8:138714562-138714584 GGACTAGGAAGAGCAAGAGTGGG - Intronic
1049944884 9:584698-584720 GGTGCTGGAAGAGAAAAGGCGGG + Intronic
1051336556 9:16070978-16071000 GGTCCAATCAGAGCCAAAGCTGG + Intergenic
1051362540 9:16294119-16294141 GCTCCAGGAAGAGCAGCATCTGG + Intergenic
1051993921 9:23190357-23190379 GCTCCAGAAAAAGCAAAAGCAGG + Intergenic
1054923014 9:70560576-70560598 GAGCCAGGAAGAACAAAATCAGG + Intronic
1056393082 9:86156554-86156576 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1056811484 9:89768475-89768497 GGTCCAATCAGAGCAAAAGCAGG + Intergenic
1057966634 9:99510438-99510460 GCTCCAAGTAGAACAAAAGCTGG + Intergenic
1060213458 9:121724340-121724362 GTTCCAGGAAGAGAAGAAGAGGG - Intronic
1061452405 9:130675420-130675442 TGTCCAGCAAGAGCACAGGCTGG - Intronic
1062200479 9:135300249-135300271 GCTCCAGAAGGAGCAAGAGCCGG + Intergenic
1062453143 9:136623861-136623883 CGGCCAGGAAGGGCAGAAGCTGG + Intergenic
1203501855 Un_KI270741v1:29528-29550 GGTGGAGGAGGAGCATAAGCTGG - Intergenic
1187053501 X:15717866-15717888 GGGCCAGTAAGAGAAAAGGCTGG - Intronic
1187424370 X:19163888-19163910 AGTCCGGGTAGAGCAAAAACAGG - Intergenic
1187564269 X:20433060-20433082 GGTCCAGAAAGGTCAAATGCTGG - Intergenic
1190726369 X:53193155-53193177 GGTCCAGGAGGAGGAAGAGCTGG - Exonic
1193360066 X:80571273-80571295 ATTCCAGGAATAGCAAATGCTGG + Intergenic
1193686364 X:84581120-84581142 GGTGAAGGAGTAGCAAAAGCAGG - Intergenic
1195012574 X:100747499-100747521 GGACTAGGAAGAGTAAAAACTGG + Intergenic
1195790215 X:108576326-108576348 TGTTTAAGAAGAGCAAAAGCAGG + Intronic
1197268531 X:124401574-124401596 GGTCCAGGAAGAGAGAAAATTGG + Intronic
1197269761 X:124412909-124412931 GGAGGAGGAAGAGCAGAAGCAGG + Intronic
1197768792 X:130075951-130075973 GGCCCAGGAGGAGGAAGAGCAGG + Intronic
1198219430 X:134586168-134586190 GGTCCAAGAAGACCAACAACTGG + Intronic
1198486815 X:137095480-137095502 GGTCCTGTAACAGCATAAGCAGG - Intergenic
1200053038 X:153444821-153444843 GGTGCAGGAAGATCAGGAGCAGG + Exonic
1200801273 Y:7389066-7389088 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1200966482 Y:9043957-9043979 AGTACAGGAAGAGCAGAAGTTGG - Intergenic
1201422353 Y:13813361-13813383 GAGCTATGAAGAGCAAAAGCGGG - Intergenic
1201429398 Y:13889663-13889685 AGTACAAGAAGAGCAGAAGCTGG - Intergenic
1201530306 Y:14984255-14984277 AGTGCAGGAAAAGCAGAAGCTGG - Intergenic
1201568847 Y:15393025-15393047 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1202146965 Y:21808216-21808238 AGTACAGGAAAAGCAGAAGCTGG + Intergenic