ID: 1030549312

View in Genome Browser
Species Human (GRCh38)
Location 7:110938068-110938090
Sequence ACTGATATGCATACTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030549312_1030549320 29 Left 1030549312 7:110938068-110938090 CCTCTCCCAGTATGCATATCAGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1030549320 7:110938120-110938142 TTTTCGTGTTATCGTCTGTCAGG No data
1030549312_1030549315 -9 Left 1030549312 7:110938068-110938090 CCTCTCCCAGTATGCATATCAGT 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1030549315 7:110938082-110938104 CATATCAGTTCAGCTCTTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030549312 Original CRISPR ACTGATATGCATACTGGGAG AGG (reversed) Intronic
902852206 1:19168315-19168337 ACTGTTATTCATGCTGGGAAGGG + Intronic
903825214 1:26139885-26139907 TCTCATCTGCAAACTGGGAGAGG - Intergenic
903995396 1:27302329-27302351 AATGGTGTGCATGCTGGGAGGGG + Intronic
910061767 1:83102444-83102466 ACTTATATGCACGCTGGGTGGGG + Intergenic
911506065 1:98753158-98753180 ACTGATATGAATACTTGGTCAGG - Intronic
915847046 1:159277442-159277464 ACTGATGTGACTACTGGGAGAGG + Intergenic
917467778 1:175298147-175298169 ACTGTTATGCAAACTGGGATTGG + Intergenic
917688958 1:177447957-177447979 AAGGACATGTATACTGGGAGAGG + Intergenic
918294643 1:183144813-183144835 ACTGATGGGTAGACTGGGAGAGG + Exonic
921160942 1:212471827-212471849 ACTGAAATGAATACAAGGAGTGG - Intergenic
1063780676 10:9319394-9319416 ACTGATATGCATATTGCTACAGG - Intergenic
1063836930 10:10025764-10025786 AATGATATTCAAAGTGGGAGAGG - Intergenic
1064175554 10:13072078-13072100 ACTGGTTTGCAAAGTGGGAGGGG - Intronic
1067415172 10:46097211-46097233 ACTGATCTGCAGACTGGCTGGGG + Intergenic
1067435208 10:46272260-46272282 ACTGATCTGCAGACTGGCTGGGG + Intergenic
1070538180 10:77394801-77394823 ATTGACAGGCATACAGGGAGTGG + Intronic
1072453206 10:95555433-95555455 ACTGATATGCATATTTACAGAGG + Intronic
1074331012 10:112509487-112509509 CCTGATATGTAAACTGGAAGAGG - Intronic
1075700531 10:124466745-124466767 AATGATATGCAGGCTGGGCGCGG - Intronic
1077230867 11:1457656-1457678 GCTGAGATGCAGGCTGGGAGAGG - Intronic
1077356711 11:2122144-2122166 ACTGAAAGGCAGACTTGGAGAGG + Intergenic
1077853208 11:6095851-6095873 ATTCATGGGCATACTGGGAGGGG + Intergenic
1081473486 11:43400334-43400356 ACTGATATGCATATTAGGGTAGG - Intronic
1082679692 11:56152669-56152691 ACTTATATGGATGCTGGGTGGGG - Intergenic
1083661478 11:64253499-64253521 ACTGAGATGCATTTTGGGGGTGG + Intronic
1091632836 12:2175323-2175345 AATGACATGCAAAATGGGAGGGG - Intronic
1093815798 12:23545213-23545235 AGTGAGATGCATACTTTGAGAGG - Intronic
1096762136 12:53850663-53850685 TCTGATATGGATATAGGGAGGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1107011529 13:35675446-35675468 ACTGTCATGCAGGCTGGGAGAGG - Intergenic
1107833445 13:44394779-44394801 ACTGGTCTGCATGCTGGGACAGG + Intronic
1108161212 13:47641771-47641793 ACTGAAAGGCATACTGGAAGGGG + Intergenic
1111201414 13:84942676-84942698 ACTGATATGCTCACTGAGTGTGG + Intergenic
1112173751 13:97000391-97000413 ACTGATACATATTCTGGGAGGGG + Intergenic
1115305121 14:31925674-31925696 ACTGATATCCACTCTGGGAATGG - Intergenic
1115484934 14:33901459-33901481 ACTGAAGTGAGTACTGGGAGTGG - Intergenic
1118485167 14:66207632-66207654 ACTTATAATCATACTGGAAGCGG - Intergenic
1119542219 14:75447601-75447623 ACTGATGAGCATCCTGAGAGTGG + Intronic
1121044524 14:90778174-90778196 AGTCACATGTATACTGGGAGAGG - Intronic
1125685322 15:41560044-41560066 ACTGATGGGCATATAGGGAGCGG + Intronic
1126512428 15:49494593-49494615 ACTGGTATGAATACTGTGTGAGG - Intronic
1128939872 15:71779239-71779261 ACAGATAAGCATCCTGGCAGAGG + Exonic
1133937084 16:10277970-10277992 ACTTATATGGATGCTGGGTGAGG - Intergenic
1141084425 16:81081580-81081602 AGTGATATGGCTACTGGCAGAGG + Intergenic
1141327878 16:83079384-83079406 ACTGTGATGCATACTGGATGTGG + Intronic
1156551526 18:38024155-38024177 ACTGGTGTCCATACTTGGAGTGG - Intergenic
1156836373 18:41560207-41560229 TCTGATAAGCATACTGTGAGAGG + Intergenic
1157019132 18:43758039-43758061 AATGATTTGCTTGCTGGGAGAGG + Intergenic
1159764413 18:72470494-72470516 AATGATATGCAAAGAGGGAGTGG - Intergenic
925679936 2:6409735-6409757 ACTGCAATGCAGGCTGGGAGTGG - Intergenic
926767670 2:16336509-16336531 ACTGAGATGTACACTGGGAATGG - Intergenic
926777647 2:16438351-16438373 AATGCTGGGCATACTGGGAGCGG + Intergenic
928459504 2:31457381-31457403 ACTCATTTGCATACAGTGAGAGG - Intergenic
932976556 2:76608139-76608161 AGTGAGATTCATTCTGGGAGTGG + Intergenic
933604318 2:84365851-84365873 CCTGATATGAAAACTGGCAGTGG + Intergenic
939615211 2:144354694-144354716 ACTGATTTGCAGGCTTGGAGAGG + Intergenic
940056254 2:149515302-149515324 ACTGATGTGCAGGCCGGGAGCGG - Intergenic
940347789 2:152645556-152645578 ATTGATCTGCATACAGAGAGAGG - Intronic
945630686 2:212272053-212272075 ATTGCTATGAAAACTGGGAGAGG - Intronic
945853983 2:215045322-215045344 ACTGATATGCAGGCTTGGAAAGG + Intronic
1175969339 20:62675898-62675920 AAAGACATGCATCCTGGGAGAGG + Intronic
1185004271 22:48266257-48266279 ACGGACAGGCATGCTGGGAGTGG + Intergenic
949197511 3:1330727-1330749 ACTTATATGCATACCAGGATGGG + Intronic
949340572 3:3026123-3026145 AGTGACATCCATACTGGAAGGGG - Exonic
952800791 3:37289014-37289036 ACTGTTCTGCATCCTGGCAGTGG - Intronic
953136815 3:40188947-40188969 ATTGATCTGCATGCTGGGGGTGG - Intronic
953435170 3:42872087-42872109 ACTGATAAGCACGCTGGGAAGGG + Intronic
954714984 3:52522489-52522511 AATGAAATGGGTACTGGGAGTGG - Intronic
957560814 3:81818233-81818255 ACTGATATAGTTACTGGCAGAGG - Intergenic
966081775 3:176013367-176013389 ACTTATATGCATACTTAAAGTGG + Intergenic
967611610 3:191512471-191512493 ACTTATATGCATAATTGAAGAGG + Intergenic
969789390 4:9481532-9481554 ACTGATATCCATAGGGAGAGAGG - Intergenic
978490451 4:109306120-109306142 ATTGATATGCCCACTGGGAAAGG + Intergenic
985215763 4:187651986-187652008 ATTGATATGTATTCTGAGAGAGG - Intergenic
988596532 5:32597430-32597452 ACTGATAAACAAAATGGGAGAGG - Intronic
990204811 5:53417197-53417219 ACTGATATGTAGGCTGGGTGCGG - Intergenic
993733566 5:91449790-91449812 ACTCATATGAACTCTGGGAGAGG - Intergenic
1005715008 6:28538811-28538833 AGGGATATGCATACAGGGATGGG - Intergenic
1006311857 6:33266700-33266722 CCTCAAATGGATACTGGGAGAGG + Exonic
1007256061 6:40529622-40529644 ATTGATTTGAATACAGGGAGTGG - Intronic
1012773789 6:103478570-103478592 TCTGATATCCAGAGTGGGAGAGG + Intergenic
1012945514 6:105461481-105461503 ACTGAAATGCCTTATGGGAGGGG - Intergenic
1018479031 6:164171542-164171564 AGTGAGCAGCATACTGGGAGGGG + Intergenic
1018694617 6:166382333-166382355 ACTGTTATGCCTACCAGGAGAGG + Intronic
1020970103 7:14925873-14925895 AAAGACATGCATACTGGAAGTGG - Intronic
1030549312 7:110938068-110938090 ACTGATATGCATACTGGGAGAGG - Intronic
1031475130 7:122212020-122212042 ACAGAATTGCATACTGAGAGTGG - Intergenic
1032980517 7:137276738-137276760 ACTGGTATACATCCTAGGAGAGG - Intronic
1037594003 8:20338815-20338837 CCTGATAGGCATACCTGGAGTGG + Intergenic
1045612743 8:103865573-103865595 ACTGATATGGATGCTGGGTGTGG - Intronic
1047608255 8:126495980-126496002 ACTGATATGCATACTCTGCATGG - Intergenic
1049780424 8:144426267-144426289 ACTGAAATGGAGACTGGGACTGG - Intronic
1052389720 9:27865412-27865434 ACTGAAATGGATCCTTGGAGAGG - Intergenic
1054864671 9:69987852-69987874 ATTGATATGCATATTGGGGAGGG - Intergenic
1060566235 9:124594576-124594598 ATTTCTATGCATACTGGGGGAGG + Intronic
1062206348 9:135339621-135339643 CCTGACATGCTTGCTGGGAGCGG + Intergenic
1186451816 X:9680263-9680285 TCTGATATTCATTCTGGGACAGG - Intronic
1186610716 X:11135673-11135695 TCTGATAAGCAAACTGGGGGAGG - Intergenic
1189165778 X:38859405-38859427 ACTGCTATGGATAGGGGGAGCGG + Intergenic
1189316162 X:40058226-40058248 ACTGCTCTGCTTACTGGGAGCGG - Intronic
1190118338 X:47640094-47640116 ACTGGTATAAATATTGGGAGGGG + Intronic
1191965825 X:66757162-66757184 GCTGATATGGATATTGGGGGAGG + Intergenic
1192442389 X:71184181-71184203 ACTGAGATGAAAAGTGGGAGTGG + Intergenic
1195692278 X:107636776-107636798 ACTTATATGAAAACTGGCAGAGG - Intronic
1201643664 Y:16204064-16204086 CCTGATATCCATTCTGGGTGGGG + Intergenic
1201659151 Y:16381257-16381279 CCTGATATCCATTCTGGGTGGGG - Intergenic